This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Extract the DNA sequence header!

I have question about our DNA sequence data. If the format of sequence data is

@HWI-ST1234:136:C5F6VACXX:6:1101:4121:2231 1:N:0:ACTTGA
TATGGGTTTCCACGGAGCACAGTGCCTAGTGCTCACTCCCCAGTTGTATCTTATTTTTCAGGTCAGCAGGTCGGGCCGGGAGTGTGACATGACGGAGCAGA
+
CCCFFFDDHHHHHJJGIJJJJJHIJJIJJHIJIJIJJJJJJIIIIJGIIBFHHFHJJJG>FHIJIGIIEHAHBBAB@BDBDD<?ACA>CDDDDDD5<BBD?.

I can extract the sequence identifier as @HWI-ST1234:136:C5F6VACXX:6:1101:4121:2231 1:N:0:ACTTGA using the code.

If the format of sequence data is

@HWI-ST1234:136:C5F6VACXX:6:1101:4295:2242 1:N:0:ACTTGA
AATACTTGTACGAGGGTGTTTTGCCACACCATATCTCATAAGGTGTGTTGGGTACATCTTTACTTGTCATTCTATTCAAAATATGTGTTGTTGTTTC
+
@@@ADD?DH8FH1CGG2A<F@FH?@?FC1DFGEDB9?BFHHIF?8?DBC=FB5@CDA;@)=.))..).;;B@B?@>>BDCCCCCD>B;?=5??<?CC

I can not extract the sequence identifier.

So I think the problem is the sequence data. The first symbol of second one is @. The first symbol of identifier also is @. So the code can not extract the correct sequencing identifier from our sequence data.

I want to extract the sequence identifier from my sequence data. The identifier format is @HWI-ST1234:136:C5F6VACXX:6:1101:4295:2242 1:N:0:ACTTGA. Could you help me do it?

Thanks,
Fuyou

genome fastq
• 2,575 views • link
updated by Ram Ram • written by fufuyou fufuyou

Goutham and Ashutosh,

Thanks,

It is working.

• 0 views • link
updated by Ram Ram • written by fufuyou fufuyou

2 answers

You just need to print the read name which is the first line of every 4 lines in fastq format. Something like:

awk '{if (NR%4==1) print}'​
• 0 views • link
updated by Ram Ram • written by GouthamAtla GouthamAtla 
cat Input.fastq | paste - - - - | cut -f1 > ReadIDs.txt

Goutham's solution that purely uses awk should be much faster.

• 0 views • link
updated by Ram Ram • written by Ashutosh Pandey Ashutosh Pandey

Log in to answer this question.

More posts like this
  • Loss of reads during realignment bam
    written by mb2subi • mb2subi
    I everyone, I am trying to realign a bam file from hg37 to hg38. The problem is that I am losing half of the reads …
  • Demultiplexing Illumina data
    written by dbro970 • dbro970
    Hi, I'm fairly new to bioinformatics in general but have some Illumina Sequence data in the form of two sequence files and a seperate barcode …
  • Separate the reverse sequence from R1 and corresponding forward seq from R2
    written by Sajan Raju • Sajan Raju
    Hi, Recently we have sequenced (V3-V4 region of16S) some samples with half of amplicon with adapters switched. Using the F primer 5' CCTACGGGNGGCWGCAG 3' & …
  • sam to bam header not being retained
    written by chrisclarkson100 chrisclarkson100
    I have a series of sam files that I would like to convert to bam files and merge into one bam file. The downstream analysis …
  • BAM to FASTQ
    written by michaela_boell michaela_boell
    Dear all, I am trying to write a fastq file (to be more exact a fastq sanger) from a bam file. I tried to install …
  • R: Write a SAM file
    written by michaela_boell michaela_boell
    I have a SAM file, created by Bowtie2, that contains a lot of reads. I wrote an R script to sort out reads according to …
  • fastqc quality leading reads are all same
    written by sacha sacha
    I get 16sRNA sequencing from illumina MiSeq. I Run fastQC and I get the following quality plot. Why the first 6 position has the same …
  • searching reads with a certain sequence in fastq file
    written by sumithrasank75 sumithrasank75
    I have a file say master.fastq which looks like : ``` @M00990:202:000000000-ADM27:1:1101:21678:1536 2:N:0:291 CCTTTTACCGACCCGCTCTTTCTCTCCTACGCTTATTTCCGTCTACCCTTCTCTTCACTCGCTATTTCTATTCTTAAAACTATCTTAATGTTCTGCCTTTGCTCTTTTCTTTTTTCTATAACCTCTCTACAGCCAACTCACCCATCTCCTTCCCTGCTACGCTATTCCTCTGTTAGTTTTTCTTCATCATACTTTTCTCATCTCACACTACCTTTGCACTTCTTCCTTTCCACGTCCCCTTTCTCCTACC + -----,,6;6,@+8++6+,,,<C5@,,,,,,+8,,;,,<,,,,,,,;,,;,,,<C,,,;,,8,,8CC,C,,,5,C,,,,99,+,+4,,,3,,9,,6,@<,,,,,,,9,,,,,,,4),,0**,,5),,5**,)59*0),,*)5,)))*,9,3,0++))5D:)))))5;+;+0)*;+*6++++),******3**50,6,+++**,0*,,31)88*0*1*5*1)0*:*7>C;3,035:0)))8).*2**.*:) @M00990:202:000000000-ADM27:1:1101:22685:1539 2:N:0:291 CTTATCACCGACTCTCTCCTTCTCTTCCAAGTTTATTTCCGACTCCCCTTATCTTCACTTGCTATTTCTATTCTTAAAACTATCTCGACCTTTCACCTTTCCCTCTTTCCTTCTTTTCTCTCCTTCTACACTCCCACCCACTCTTACTTCTTTCTTGTCACCGTTTCCATATTATACTTTCTTCTCTTACATAATTTTCTTCCTGCAAACTATTTAAGCAATCTCTTTCTTTCACCCCTTTTATCTCGCC + -----,,<;67@+B,,6,,,,;C5@,,,,,66<,,6,,<,,,66,,;,66,,;;C,,,;,4<,,<CC6C,;,,,;,,6,:,6?A9=,,+++2,5,,,9<?D,,,,,:C?,@,@,,5,?*3*,9**,,0**,*)93))4+))19*0**,,52,56+**5*03*)3)))42+2***5*+=3+,*4*2****,**2*,3,+++*0,50,,**5*****0****)5)***0**,,***3*)0)))3***0*))) ``` I want only …
  • Extracting multiple sequences by ID from a FASTA file
    written by Allan • Allan
    Following the instructions as shown in https://www.biostars.org/p/2822/ for retrieving a list of sequences by ID, the only instance this works correctly is for the last …
  • Parsing Fastq Files
    written by deepthitheresa • deepthitheresa
    <p>Hi all,</p> <p>I have Fastq reads something like </p> <pre><code>@HWI-ST1162:73:C0KEFACXX:6:1101:1816:1918 1:N:0:CGATGT NACCCTAGAAATTATAAATCTCTTCAAGTGAGATTGTAAGGAGAAGGAGAAACTTGGTCTGGAATTTGTTATAAAAGCACTT + #1=DDFFFHHGGHIJJJJJIJJJJJJJJCHGHIIJJEFHIJIJJIIJIIIIJHHIJJFHIIJJJJJJJIJIJIJIIJHEHHHHFFFFFFEEEDEEEDCDDC </code></pre> <p>I aligned this fastq file with a reference genome using …