Or just
awk 'NR%4==1'
I have question about our DNA sequence data. If the format of sequence data is
@HWI-ST1234:136:C5F6VACXX:6:1101:4121:2231 1:N:0:ACTTGA
TATGGGTTTCCACGGAGCACAGTGCCTAGTGCTCACTCCCCAGTTGTATCTTATTTTTCAGGTCAGCAGGTCGGGCCGGGAGTGTGACATGACGGAGCAGA
+
CCCFFFDDHHHHHJJGIJJJJJHIJJIJJHIJIJIJJJJJJIIIIJGIIBFHHFHJJJG>FHIJIGIIEHAHBBAB@BDBDD<?ACA>CDDDDDD5<BBD?.
I can extract the sequence identifier as @HWI-ST1234:136:C5F6VACXX:6:1101:4121:2231 1:N:0:ACTTGA using the code.
If the format of sequence data is
@HWI-ST1234:136:C5F6VACXX:6:1101:4295:2242 1:N:0:ACTTGA
AATACTTGTACGAGGGTGTTTTGCCACACCATATCTCATAAGGTGTGTTGGGTACATCTTTACTTGTCATTCTATTCAAAATATGTGTTGTTGTTTC
+
@@@ADD?DH8FH1CGG2A<F@FH?@?FC1DFGEDB9?BFHHIF?8?DBC=FB5@CDA;@)=.))..).;;B@B?@>>BDCCCCCD>B;?=5??<?CC
I can not extract the sequence identifier.
So I think the problem is the sequence data. The first symbol of second one is @. The first symbol of identifier also is @. So the code can not extract the correct sequencing identifier from our sequence data.
I want to extract the sequence identifier from my sequence data. The identifier format is @HWI-ST1234:136:C5F6VACXX:6:1101:4295:2242 1:N:0:ACTTGA. Could you help me do it?
Thanks,
Fuyou
You just need to print the read name which is the first line of every 4 lines in fastq format. Something like:
awk '{if (NR%4==1) print}'
Or just
awk 'NR%4==1'
cat Input.fastq | paste - - - - | cut -f1 > ReadIDs.txt
Goutham's solution that purely uses awk should be much faster.
Log in to answer this question.
Goutham and Ashutosh,
Thanks,
It is working.