Thank you for that. Good solution to keep on file.
What different programs are you referring to for this specific case (where the index sequences are in a separate file)?
Hi, I'm fairly new to bioinformatics in general but have some Illumina Sequence data in the form of two sequence files and a seperate barcode file. I’m trying to demultiplex this data, but can't seem to find a way to do it? Can anyone give me some advice?
Read File 1:
@HWI-M01156:58:000000000-A14TV:1:1101:15941:1367 1:N:0:
TACGTAGGGTGCGGGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTTATTTAAGTGAGGTGTGAAATCCCCGGGCTTAACCTGGGAATTGCATTTCTGACTGGGTAACTTGAGTACTTTTGGGGGGGGTAGAATTCCACGTGTAGCGGTGAAATGCGTAGAGATGTGGGGGAATACCGAAGGCGAAGGCAGCCCCTTGGGATTGTACTGACGCCCTTGTGGGAAAGGGGGGGGGGCAAACG
Read File 2:
@HWI-M01156:58:000000000-A14TV:1:1101:15941:1367 3:N:0:
CCTTTTTTCTCCCCACTCTTTCGCTCTTTTTCTTCTTTTCTTTCCCTTTTTTTTTCCTTCGCCTTCTTTTTTCCTCCTCATCTCTTCGCTTTTCACCGCTNNNCNNNTNNTTCTTCCCCTCTCTTACTTACTCTCTTTTCCCATTCTCCATTTCATTTCCTTGTTTTTCCCCGTTCTTTTCCCTCTTTCCTTTATTTCCCTCCTCCTTCCCCTTTCCCCCCTTTTTTTCCTTTTTTCCTCTCCCCCTTCCT
Barcodes:
@HWI-M01156:58:000000000-A14TV:1:1101:15941:1367 2:N:0:
TTCCGTAGGGTT
Thanks Heaps in advance!
Thank you for that. Good solution to keep on file.
What different programs are you referring to for this specific case (where the index sequences are in a separate file)?
I think Bayexer can do this as well, they compared it to deML in their paper. I am not sure about the input format though but it is another third-party demultiplexer.
I noticed that your solution requires a file with index sequences. It may be cumbersome if one is dealing with molecular tags etc. Can deML be made to work without the index file?
I assume you refer to the files containing the per cluster index. At present time, you would need to dump those in a file or file descriptor but I could modify it easily by adding an option if someone requests it.
Like in this case OP may/may not have a list of all index sequences. As you said the index list could be extracted from the I* file but making the program independent of that requirement may make it friendlier to use.
I am slightly confused, are you referring to the per-cluster index sequence or the list of the all potential index sequences?
Hi, Thanks everyone for your answers, these are old data unfortunately that we've got from a collaborator so I don't think that the demultiplexed data is available and I don't have an index file but I'd be interested in hearing more about how you could extract an index file from the files I've already got though? Thanks everyone!
I mean you could get a frequency of the different sequences in the index file but how will you know what sample they pertain to?
You can extract unique indexes from the I* file by doing this:
zcat File_I1_001.fastq.gz | grep -B 1 "+$" --no-group-separator | grep -v "+$" | sort | uniq > index.txt
As @Gabriel said, you would need to know the mapping information to make use of the demultiplexed data.
Sample 1 <--> Index 1
Sample 2 <--> Index 2
etc.
Hi, So I have mapping information however unfortunately this only connects the sample identifier to the relevant metadata and doesn't contain any information such as the barcode/linker sequences etc. I also only have some of the identifiers in this file as while I have the raw read data from several sequencing runs only some of the samples on these runs are relevant for my analysis (so the remaining identifiers are with held for data confidentiality reasons).
@genomax, thanks a bunch for the script, I've been running the code like this:
zcat s_1_1_sequence.fastq.tar.gz | grep -B 1 "+$" --no-group-seperator | grep -v "+$" | sort | uniq > index.txt
unfortunately I keep getting the error
grep: unrecognized option '--no-group-seperator'
Usage: grep [OPTION]... PATTERN [FILE]...
Try: 'grep--help' for more information
Thanks everyone for all of your help!
Try this command instead then. Make sure you are running it using the file containing the index sequences (short reads). That appears to be file 2. Your file also appears to be tarred and gzipped. so you may be best off uncompressing the file. You could pipe these things but let us do it the dumb way.
tar -zxvf s_1_1_sequence.fastq.tar.gz
cat s_1_1_sequence.fastq | grep -B 1 "+$" | grep -v "+$" | grep -v "\-\-"| sort | uniq > index.txt
Thanks for all your help genomax, I've tried running that code. I'm curious how you could determine that file 2 is the file which contains the index sequences, I'm not sure myself so I ran it on all of the files just to check the output. It seems to be isolating the sequences but not then associating them with the relevant sample ID (see below for the first line from each file). Can you think of a reason this might be occuring? Thanks for all of your help with this so far, your a legend!
Code run on first file (read file 1)
AAAAAAAAAAAACAGGAGAAGGAAAGCGAGGGTATCCTACAAAGTCCAGCGTACCATAAACGCAAGCCTCAACGAAGCGACGAGCAGGAGAGCGGTCAGGAGAAATGCAAACGAGGTGACCCGGCAGAAAATCGAAATAACCGTCGGTTAAATCCAAAACGTCAGAAGCCGTAAAGAGCATAAAAGAGCCGAAAGCGGGCGGGAAACGAACGGGAGGTGCAGAAACTTGTCCCATGTGACCTAACCGACAA
Code run on the second file (read file 2)
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
code run on barcodes file
AAAAAAAAAAAA
AAAAAAAAAAAC
In Illumina technology order of reads is as follows (Index reads present only when sample is single- or dual-indexed):
Read 1 --> Index 1 --> Index 2 --> Read 2
Corresponding fastq files get named as (unless changed):
R1 --> I1 --> I2 --> R2 (or they could also be named R1, R2, R3, R4)
You are going to find many non-sense index sequences (there are always errors and other things one can't explain) that you would need to weed through.
You would then take the indexes you are interested in put them in the index.txt file and then use @Gabriel's tool
AAAAAAAAAAAA
AAAAAAAAAAAC
As we have already said you need to have the metadata for the sample-index association since there is no way to recover that from this analysis.
Hi @Gabriel R.,
Thank you so much for providing the program ! I am actually using your program to try to demultiplex my Miseq data which contains 2 reads and 1 index (same as above). I tried to create an index file as @genomax described below, but I got this error when I ran it: Error: line AAAAA...AAC does not have 2 or 3 fields.
Could you help me elaborate this error and guide the way to fix it ? Thank you so much !
could you post the offending line? Put 4 whitespaces before the line to keep the format.
Log in to answer this question.
See this thread: demultiplex a dataset when you have barcodes as a separate fastq
If it is easily feasible ask the sequence provide to demultiplex the data without putting the index read in a separate file (this is standard way of demultiplexing data).