Demultiplexing Fastq based on barcodes on identifier line
I have multiplexed Fastq files which have barcodes appended to the end of the identifier line rather than on the sequence line. The data did not come with a 3rd barcode fastq that some tools require. Is there a simple available tool or approach to demultiplex these files and deal with some errors in the barcode?
Example:
@K00156:138:HGVJ2BBXX:1:1101:1742:1033 1:N:0:NAGATCAT
NTCAGACCGCGTTCTCTCCCTCTCACTCCCCANTACGGAGAGAAGAACGATCATCAATGGCTGACGGCAGTTGCAGCCAAGCAACGCCAGAAAGCCGGCTT
+
#AAFFJJJJJJJFJJFJJJJFJJJJJJJJFJJ#JJJJJJJJFJJJJJJJJJJJJJJJJJAJJ7AJ<<JFJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJ
• 3,738 views
•
link
written
by
rkacharya1337 •
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Sample-level demultiplex raw FASTQ file
written by Bhavya •
-
Demultiplexing 10x fastq files by GROUPS of barcodes
written by bds1217 •
-
Demultiplexing with barcode at random location in sequence
written by gregoryvb •
-
Demuxbyname.sh dual index problem
written by damt0320 •
-
Demultiplex Illumina run using custom index configuration
written by alba.rodriguezmeira •
-
deML: ERROR: Discrepancy between fastq files, different names with first index
written by boonfei •
-
Demultiplexing Illumina data
written by dbro970 •
-
Demultiplex pair-end fastq reads with barcode 2 in the identifier line
written by cb1579 •
-
If the index sequences in my Illumina FASTQ headers aren't the barcodes, then what are they?
written by jenn.drummond
-
Demultiplexing fastq file on Identifier line allowing mismatch
written by pat2402 •
Use solutions offered by @Brian or @Pierre here: Splitting a fasta file on the basis of header barcodes or A: Demultiplexing fastq files with dual barcodes