Barcode adapters’ sequences for Ion GeneStudio S5 series · Biostar

This is a test version of Biostars. For the public version, visit https://www.biostars.org.

Barcode adapters’ sequences for Ion GeneStudio S5 series

Hi. I would like to know where can I find the list of all barcode adapters’ sequences for Ion GeneStudio S5 series (for example S5 Prime System). I want to use it in Trimmomatic for adapter trimming during NGS data analysis. Unfortunately, I was not successful in finding such a thing in related documents for library preparation on Thermofisher webpage.

Any help would be highly appreciated.

torrent genestudio series ion adapters s5 barcode

• 1,580 views • link

written 3.3 years ago by Alireza.Tafazoli •

FAQ says this

The sequences for the barcodes can be found in the Barcodes section of your Torrent Browser. You can also download a .csv file containing the full list of sequences in that set.

You may need to download Torrent browser software.

• 0 views • link

written 3.3 years ago by GenoMax

Thanks GenoMax for your guidance.

• 0 views • link

written 3.3 years ago by Alireza.Tafazoli •

0 answers

No answers yet.

Log in to answer this question.

More posts like this

Impact of polyA trimming strategies on paired-end RNA-seq data for alternative splicing analysis
written 3 months ago by mahsa80.mm •

I am analyzing paired-end RNA-seq data with the primary goal of studying alternative splicing. As part of the preprocessing pipeline, I performed quality control and …
Adapter trimming using fastp
written 3.1 years ago by Shin Taguchi •

Hi everyone. I use Trimmomatic for adapter trimming, but plan to use fastp in the future. Adapter trimming with Trimmomatic allows us to specify seed …
Forum: Trimming tools - your experience please?
written 4.7 years ago by paigemiller •

Hello, I just posted a comment about trimming in another thread. Now I would like to ask anyone who has experience (or any desire to …
Adapter trimming with trimmomatic
written 5.0 years ago by Mozart

Dear all, I have a question about the use of trimmomatic. I have used the Illuminaclip step (The one which removes adapters) in trimmomatic even …
Trimming overrepresented sequence possible with Trimmomatic?
written 5.2 years ago by ella •

Dear Community, :) I am using Trimmomatic for quality trimming and adapter removal from my RNA reads, before I continue with mapping (via GSNAP). Unfortunately, …
Which adapters to use for trimming?
written 5.6 years ago by whb •

Hi All, I have some Sureselect XT2 and Novaseq data, I used Agilent AGenT trimmer as suggested by Agilent but FASTQC showed that there are …
Trim NEBnext Adapters with trimmomatic - Same as TruSeq adapters?
written 6.5 years ago by alexgoro13 •

Hello, I have a similar question. Recently we did NGS library preparation for target enrichment of genomic libraries and we used the NEBNext® Multiplex Oligos …
How to trim adapters from fastq having 8mer+8mer bar-code
written 8.2 years ago by rice.researcher

I generally analyze paired-end illumina platform geretaed fastq having 6mer barcode. For ex, @K00171:40:H3KJTBBXX:8:1101:20518:2020 2:N:0:CGATGT GCTGCTTCAATCCTTTCCTCTACTGTCATGTCACTTCGGGCTTTCCCCTCTTTGACATCAATAAGTTCAACTTCATAAACAAGGTCTGCCATCAATCGTTA + A,A,F<KAFKFKFKFKKFKAFAFKAKKKFKKAFKKKKKKKKAAAAKKKKKKAKKFKKKKKKKFAKFA7FFFKKKKKFKFKFKFKFKKKKKKFFKKFKKKFK For removing the adapters, I run the …
Do I need to download any specific adapters for Illumina small RNA sequencing kit?
written 9.4 years ago by bioinforesearchquestions

Hi Friends, Recently we sequenced small RNA sequencing using Rapid Run platform. As the size of the small RNA ranges between 18 to 35bases. The …
Custom sequences vs supplied sequences in trimmomatric
written 9.5 years ago by ofonov •

I would like to cut adapters in my PE data set with trimmomatic. The sequencing facility supplied two adapter sequences with the data: Universal adapter: …