trimming adapter sequences

enter image description here Hi all, I have dataset from GEO database and I dont know the adapter sequences which were used. When I run fastqc I get results which I attached as image. I cannot find the adaptor sequences how can i find it ? platform illumina nextseq 500

adapter fastqc rnaseq

• 1,032 views • link

updated 4.3 years ago by Istvan Albert

• written 4.3 years ago by biology_inform •

1 answer

It is the Illumina Universal Adapter

use the following sequence

>adapter
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

• 0 views • link

written 4.3 years ago by Istvan Albert

More posts like this

How to find the adapter sequence of an RNAseq dataset?
written 1.8 years ago by Maryam •

I am analyzing an RNA-seq dataset (GSE174302) produced using the HiSeq X Ten platform (GPL20795) for Homo sapiens. The fastQC report revealed failed Adapter Content …
Adapter removal using cutadapt and multiqc report:
written 1.8 years ago by ayeraselvan •

Hi, I found a little bit of discrepancy over the fastqc reports after trimming them with cutadapt, (a) FASTQC report before cutadapt: I have downloaded …
How to do preprocessing from fastqc
written 2.2 years ago by Lulu •

Could someone provide a detailed guide on downstream preprocessing steps based on my FASTQC report? I conducted FASTQC analysis on a paired sample, and here …
Illumina NextSeq 500 Read Length
written 2.5 years ago by Bushra Bibi

Hi scientists, I have downloaded secondary dataset from [NCBI GEO Dataset][1] sequenced through Illumina NextSeq 500. QC report of the data tells that read length …
TruSeq Illumina adapters are BLASTed with a high confidence to some genes/terms
written 3.5 years ago by e.r.zakiev •

A FASTQC report shows an overrepresented sequence defined as "Truseq adapter" ![enter image description here][1] but when I BLAST its nucleotide sequence (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCGGAGCATCTCGTAT) ![enter image …
trimming a paired end sra
written 4.3 years ago by biology_inform •

Hi all, For the paired end sequences I took from GEO dataset, I run FastQC and For the forward read the fastqc results is like …
FASTQC report - kmer content and determining type of sequencing
written 4.7 years ago by tea.vuki •

Hello, I have two questions: 1\. Is there any way I can know what type of sequencing is used just by looking at FASTQC report? …
Find right adapter sequence for trimming
written 4.7 years ago by iamsmor •

Hello everyone I am new to RNA-seq analysis. I am trying to clean single end reads data according to fastqc result. It resulted like in …
Adapter content in FASTQ file
written 4.7 years ago by shivangi.agarwal800

Hi Guys, I am evaluating quality of multiple lane paired end FASTQ file using FastQC tool. It is showing Adapter content graph as Illumina Universal …
Find illumina adaptors
written 7.2 years ago by sabaghianamir70 •

i have a data produce from nextseq 500 and i want to find the adapters which used in my data, how do i find that …