A FASTQC report shows an overrepresented sequence defined as "Truseq adapter"
but when I BLAST its nucleotide sequence (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCGGAGCATCTCGTAT)
it aligns with high confidence to, say, coronavirus genes
Why is that? I was expecting to see the top hit saying something like "Illumina Adapter".
And also why the nucleotide sequence reported by FastQC as "truseq adapter 18" doesn't match it's namesake in one listed in Illumina's official document??????
I am asking this because i wanted to BLAST the overrepresented sequences in my data and see if they come from the ribosomal RNA contamination or not. And with results like THAT even for the adapter sequences I clearly don't understand something
1 answer
The sequence you provide is the beginning of the Illumina adapter as in the document you link. I see no problem here. It is only 0.27% of reads, so why bother?
As for this BLAST search, I would first of all check that the genome assembly has no leftovers of adapter sequences. But again, it is way less than 1% of sequences, just ignore and continue with analysis.
Log in to answer this question.