How Can I Convert Yetfasco Matrix To A Jaspar/Transfac One? · Biostar

This is a test version of Biostars. For the public version, visit https://www.biostars.org.

How Can I Convert Yetfasco Matrix To A Jaspar/Transfac One?

I perform an analysis of overrepresented transcription factor binding sites using oPOSSUM.

The issue is the following: I need to use some profiles that are not included in JASPAR. I can get those from YeTFaSCo. Then I need to convert those to JASPAR format to run oPOSSUM analysis. As far as I understand, both databases (YeTFaSCo and JASPAR) claim that they contain PFMs. But the same logos are associated with different matrices (for example, this and this represent the same motif).

Is it possible to convert a matrix from YeTFaSCo to JASPAR format?

I would appreciate any help. Thanks in advance!

• 4,202 views • link

updated 13.2 years ago by Tky

• written 13.2 years ago by pollyD •

1 answer

You may use the convert matrix in RSA tool set, check the left panel under matrix tools.

Just drop the matrix copied form YeTFFaSCo as tab format and select the output format as JASPAR, and then it is done.

For example, you target matrix looks like this in JASPAR format
>convert-matrix_2013-06-11.091446_ONQTGz_input.tab_1 convert-matrix_2013-06-11.091446_ONQTGz_input.tab_1
A  [0.181387 0.386457 0.002036 0.121673 0.0 0.001221 0.17284 ]
C  [0.184759 0.091376 0.977795 0.0 0.851711 0.001506 0.182402 ]
G  [0.304358 0.172992 0.017835 0.878327 0.0 0.995872 0.095864 ]
T  [0.329496 0.349175 0.002335 0.0 0.148289 0.001401 0.548894 ]

• 94 views • link

written 13.2 years ago by Tky

Thanks a lot! I've tried this tool before but was not sure about the input format.

• 0 views • link

written 13.2 years ago by pollyD •

Now I know two mistakes I made. They are pretty silly. First, the JASPAR database rounds to two digits, and I this makes the the same matrix different for the program. Second, some matrices may be reverse complement. Thanks a lot again!

• 0 views • link

written 13.2 years ago by pollyD •

It is great to hear that, and thanks for sharing the your experience :-)

• 0 views • link

written 13.2 years ago by Tky

Log in to answer this question.

More posts like this

motif discovery for small set of genes
written 6.9 years ago by Calangoa •

Hi there, I am not familiar with motif discovery and I have a question, I have a small set of genes extracted from microarray data …
JASPAR Position Frequency Matrix has unequal column sum
written 8.9 years ago by fmhsu0114 •

Hi, I used to believe that all column sums in a PFM (or position count matrix) should be equal since the matrix is derived from …
Exome Variant Server: What Are Those Gaps ?
written 12.6 years ago by Pierre Lindenbaum

<p>Here is a screenshot of the Exome Variant Server data: </p> <p><img src='http://i.imgur.com/6PfpkHJ.jpg' alt='http://i.imgur.com/6PfpkHJ.jpg' /></p> <p>Does anyone know what those gaps are ? Some deletions …
Entire Alignment Of A Conservation Track In Ucsc
written 12.9 years ago by anuragm

<p>I am interested in looking at the conservation of the Xenopus genome at certain positions. After that I want to be able to extract the …
What Does Fastqrd1 And Fastqrd2 Mean In Single-Ended Rna-Seq?
written 13.8 years ago by Hanfei Sun •

<p>The data is from here:</p> <p><a href="http://encodeproject.org/cgi-bin/hgFileSearch?hgsid=304378767&db=hg19&hgt_tsDelRow=&hgt_tsAddRow=&tsName=&tsDescr=&tsGroup=Any&fsFileType=Any&hgt_mdbVar1=dataType&hgt_mdbVal1=RnaSeq&hgt_mdbVar2=antibody&hgt_mdbVal2=Any&hgfs_Search=search">http://encodeproject.org/cgi-bin/hgFileSearch?hgsid=304378767&db=hg19&hgt_tsDelRow=&hgt_tsAddRow=&tsName=&tsDescr=&tsGroup=Any&fsFileType=Any&hgt_mdbVar1=dataType&hgt_mdbVal1=RnaSeq&hgt_mdbVar2=antibody&hgt_mdbVal2=Any&hgfs_Search=search</a></p> <p>(search Rd1 in the result page)</p> <p>Anyone has ideas about that? Thanks!</p>
High-Quality Zebrafish Dbsnp Database
written 14.3 years ago by michealsmith

<p>How to download zebrafish dbSNP database, in vcf format at the best?</p> <p>I've checked UCSC: <a href="http://genome.ucsc.edu/cgi-bin/hgTables?org=Zebrafish&db=danRer7&hgsid=255390817&hgta_doMainPage=1)">http://genome.ucsc.edu/cgi-bin/hgTables?org=Zebrafish&db=danRer7&hgsid=255390817&hgta_doMainPage=1)</a> It's werid there's no dbSNP column for fish; …
Gencode Gtf To Bed12 Or Psl
written 14.7 years ago by Geparada

<p>Hi!</p> <p>I has been using gene models available in <a href='http://genome.ucsc.edu/cgi-bin/hgTables?hgsid=224231545&clade=mammal&org=Human&db=hg19&hgta_group=genes&hgta_track=refGene&hgta_table=0&hgta_regionType=genome&position=chr20%3A57470705-57478733&hgta_outputType=bed&hgta_outFileName='>UCSC Table Browser</a> for a long time. Those are in BED12 or PSL and I …
Translating A Mitochondrial Cdna
written 14.8 years ago by Pierre Lindenbaum

<p>Here is the cDNA for the UCSC knowngene <strong>uc011mfh.1</strong> , a protein said to be on the <strong>chrM</strong>:5,855-7,427. <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?org=Human&db=hg19&position=uc011mfh.1">http://genome.ucsc.edu/cgi-bin/hgTracks?org=Human&db=hg19&position=uc011mfh.1</a></p> <pre><code>ATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCG TAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTA CTACACGACACGTACTACGTTGTAGCTCACTTCCACTATGTCCTATCAAT AGGAGCTGTATTTGCCATCATAGGAGGCTTCATTCACTGATTTCCCCTAT TCTCAGGCTACACCCTAGACCAAACCTACGCCAAAATCCATTTCACTATC …
Direct Url Links To Img Gene Details Using Gene Locus Tags
written 15.2 years ago by chrismgowen •

<p>I am trying to generate reports in Excel that include hyperlinks to the Gene Details provided for my organisms in IMG, but I've so far …
Why Posting Data To Plantcare With Urllib,Urllib2 In Python Returns 'Http Error 400: Bad Request'
written 15.3 years ago by Gahoo

<p>I was tring to write a python script to get data from <a href='http://bioinformatics.psb.ugent.be/webtools/plantcare/html/search_CARE.html'>PlantCARE</a>. But It alway return 'HTTP Error 400: Bad Request'. urllib and …