This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Exome Variant Server: What Are Those Gaps ?

Here is a screenshot of the Exome Variant Server data:

http://i.imgur.com/6PfpkHJ.jpg

Does anyone know what those gaps are ? Some deletions ? but I cannot find those variations in : http://genome.ucsc.edu/cgi-bin/hgTracks?db=hg19&org=human&position=chr8%3A23560300-23560500&hgt.customText=http://evs.gs.washington.edu/evs_bigwig/chr8.multiTracks.txt

PS: We've emailed EVS but we got no answer.

ucsc coverage
• 3,563 views • link
updated by DG DG • written by Pierre Lindenbaum Pierre Lindenbaum

1 answer

According to the EVS Sequence Coverage description (Description of Sequence Coverage) it is just regions that didn't meet their coverage requirements (at least one sample at 8x). It is odd that there are only about 4 base pairs sort of in the middle of the region that were considered not covered but they aren't deletions.

• 151 views • link
written by DG DG

Log in to answer this question.

More posts like this
  • link genome browser to locations
    written by Azhar • Azhar
    Hi Hellow every one, I want to link my excel file with genomic locations, with genome browser and also upload in mysql to visualize, I …
  • Human transposable elements
    written by Habil Habil
    Hi, I need the human transposable element sequences in fasta format. I couldn't find any track on the UCSC [Table][1] Browser that has this information. …
  • Newbie, SNP to gene analysis question
    written by ena4487 • ena4487
    Hi, I am learning how to identify candidate genes for schizophrenia given a SNP on the UCSC genome broswer. Can anyone familiar with this process …
  • Genes with "AK#### or BC#####" in UCSC genome browser
    written by LauferVA LauferVA
    <p>In UCSC&#39;s genome browser, in the UCSC genes track, there are genes with names like</p> <p>&quot;AK125749&quot;</p> <p>&quot;BC043543&quot;</p> <p>https://genome.ucsc.edu/cgi-bin/hgTracks?db=hg19&amp;position=chr16%3A86638082-87389581&amp;hgsid=424735207_Pl93QOaMVxkha4ECPsCKSOrWvb7V</p> <p>Are there other gene appellations like these? …
  • Extremely long RefSeq sequence for miRNA
    written by knowah • knowah
    I was taking a look at which RefSeq genes (hg19) intersected a list of 200bp genomic regions, and found a peculiar entry: [MIR548H4][1] (RefSeq NR_031680) …
  • Hyperlink To Specific Ucsc Genome Browser Page
    written by alex alex
    <p>I am trying to create a hyperlink. I have an example of </p> <pre><code>Chromosome chr15 Genomic Coords 70455115 -7042353 </code></pre> <p>So I put that into …
  • How To Select Only One Human Genome Build (Hg19) From The Encode Project'S Data
    written by Eric Ho • Eric Ho
    <p>While I looking on the ENCODE project's data in UCSC Genome Browser I discovered both data from hg18 and hg19 are shown even I only …
  • High-Quality Zebrafish Dbsnp Database
    written by michealsmith michealsmith
    <p>How to download zebrafish dbSNP database, in vcf format at the best?</p> <p>I've checked UCSC: <a href="http://genome.ucsc.edu/cgi-bin/hgTables?org=Zebrafish&amp;db=danRer7&amp;hgsid=255390817&amp;hgta_doMainPage=1)">http://genome.ucsc.edu/cgi-bin/hgTables?org=Zebrafish&amp;db=danRer7&amp;hgsid=255390817&amp;hgta_doMainPage=1)</a> It's werid there's no dbSNP column for fish; …
  • Gencode Gtf To Bed12 Or Psl
    written by Geparada Geparada
    <p>Hi!</p> <p>I has been using gene models available in <a href='http://genome.ucsc.edu/cgi-bin/hgTables?hgsid=224231545&amp;clade=mammal&amp;org=Human&amp;db=hg19&amp;hgta_group=genes&amp;hgta_track=refGene&amp;hgta_table=0&amp;hgta_regionType=genome&amp;position=chr20%3A57470705-57478733&amp;hgta_outputType=bed&amp;hgta_outFileName='>UCSC Table Browser</a> for a long time. Those are in BED12 or PSL and I …
  • Translating A Mitochondrial Cdna
    written by Pierre Lindenbaum Pierre Lindenbaum
    <p>Here is the cDNA for the UCSC knowngene <strong>uc011mfh.1</strong> , a protein said to be on the <strong>chrM</strong>:5,855-7,427. <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?org=Human&amp;db=hg19&amp;position=uc011mfh.1">http://genome.ucsc.edu/cgi-bin/hgTracks?org=Human&amp;db=hg19&amp;position=uc011mfh.1</a></p> <pre><code>ATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCG TAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTA CTACACGACACGTACTACGTTGTAGCTCACTTCCACTATGTCCTATCAAT AGGAGCTGTATTTGCCATCATAGGAGGCTTCATTCACTGATTTCCCCTAT TCTCAGGCTACACCCTAGACCAAACCTACGCCAAAATCCATTTCACTATC …