I am interested in looking at the conservation of the Xenopus genome at certain positions. After that I want to be able to extract the entire alignment of this region (preferably as a fasta file). Suppose I am looking at the tyr gene in the Genome Browser, if I click on one of the exons, I get to a page that gives me the option for 'CDS Fasta Alignment'. Clicking on it, I look at an alignment but this alignment is much shorter than the tyr gene itself.
Am I doing something wrong ? Is there another way of getting the multiple alignment for regions of interest for a genome ?
•
written
by
anuragm
1 answer
Have you looked here: http://hgdownload.soe.ucsc.edu/goldenPath/xenTro3/multiz9way/
You can do this on the command line. Convert the alignments to BED with an awk/Perl/whatever statement, sort them with sort-bed and run them through bedops --element-of -1 to get elements within a particular genomic range. See the BEDOPS docs for binaries and examples: http://code.google.com/p/bedops/
As a for instance:
$ head -1 ensGene.exonNuc.fa
>ENSXETT00000006166_xenTro3_1_24 111 0 0 GL172637:5210959-5211069+
ATGGCATCTATCATGGAAGGACCTTTGAGCAAATGGACAAACGTGATGAAAGGCTGGCAGTACCGTTGGTTTGTGTTGGATTACAACGCCGGGCTGCTCTCCTATTATACG
All the needed data are there to turn this into a UCSC BED file with a Perl script (or a more convoluted awk script). You can then filter the BED file with grep and run set operations on it with bedops to get elements of the desired genome and genomic range.
Log in to answer this question.
-
Extremely long RefSeq sequence for miRNA
written by knowah •
-
Dbsnp Lengthtoolong
written by mementomori1234 •
-
How To Select Only One Human Genome Build (Hg19) From The Encode Project'S Data
written by Eric Ho •
-
Snps Present In Dbsnp But Absent In 1000Genome And Esp Database
written by michealsmith
-
Calculating Distance To Polya Site For Each Exon For Given Gene.Name
written by Puriney
-
What Does Fastqrd1 And Fastqrd2 Mean In Single-Ended Rna-Seq?
written by Hanfei Sun •
-
How Can I Get The Whole Gene Expression Information In One Cell Line?
written by pengcui1989 •
-
High-Quality Zebrafish Dbsnp Database
written by michealsmith
-
Gencode Gtf To Bed12 Or Psl
written by Geparada
-
Perl To Retrieve Sequences From Ucsc Genome Browser
written by Cheng Zhongshan
