Thanks a lot, it's working now! I capture the package sent by firefox4 with WireShark. The Accpet header is below:
Accept: text/html,application/xhtml+xml,application/xml;q=0.9,/;q=0.8
Would it be helpful to find out the reason?
I was tring to write a python script to get data from PlantCARE. But It alway return 'HTTP Error 400: Bad Request'. urllib and urllib2 works fine with other websites.
Here're the codes.
import urllib2, urllib
url="http://bioinformatics.psb.ugent.be/webtools/plantcare/cgi-bin/CallMat_IE55.htpl"
params={
'Field_Sequence':'CTAATCTTATGCATTTAGCAGTACAAATTCAAAAATTTCCCATTTTTATTCATGAATCATACCATTATATATTAACTAAATCCAAGGTAAAAAAAAGGTATGAAAGCTCTATAGTAAGTAAAATATAAATTCCCCATAAGGAAAGGGCCAAGTCCACCAGGCAAGTAAAATGAGCAAGCACCACTCCACCATCACACAATTTCACTCATAGATAACGATAAGATTCATGGAATTATCTTCCACGTGGCATTATTCCAGCGGTTCAAGCCGATAAGGGTCTCAACACCTCTCCTTAGGCCTTTGTGGCCGTTACCAAGTAAAATTAACCTCACACATATCCACACTCAAAATCCAACGGTGTAGATCCTAGTCCACTTGAATCTCATGTATCCTAGACCCTCCGATCACTCCAAAGCTTGTTCTCATTGTTGTTATCATTATATATAGATGACCAAAGCACTAGACCAAACCTCAGTCACACAAAGAGTAAAGAAGAACAA',
'Field_SequenceName':'demo',
'Field_SequenceDate':'4.27',
'Mode':'readonly',
'StartAt':'0',
'NbRecs':'10',
'MatInspector':'Search'
}
data=urllib.urlencode(params)
print urllib2.urlopen(url, data).read()
But I can get the result page directly with curl. It's wierd! Open this link in any browser should be the same ,and it works fine.
curl "http://bioinformatics.psb.ugent.be/webtools/plantcare/cgi-bin/CallMat_IE55.htpl?Mode=readonly&StartAt=0&Field_Sequence=CTAATCTTATGCATTTAGCAGTACAAATTCAAAAATTTCCCATTTTTATTCATGAATCATACCATTATATATTAACTAAATCCAAGGTAAAAAAAAGGTATGAAAGCTCTATAGTAAGTAAAATATAAATTCCCCATAAGGAAAGGGCCAAGTCCACCAGGCAAGTAAAATGAGCAAGCACCACTCCACCATCACACAATTTCACTCATAGATAACGATAAGATTCATGGAATTATCTTCCACGTGGCATTATTCCAGCGGTTCAAGCCGATAAGGGTCTCAACACCTCTCCTTAGGCCTTTGTGGCCGTTACCAAGTAAAATTAACCTCACACATATCCACACTCAAAATCCAACGGTGTAGATCCTAGTCCACTTGAATCTCATGTATCCTAGACCCTCCGATCACTCCAAAGCTTGTTCTCATTGTTGTTATCATTATATATAGATGACCAAAGCACTAGACCAAACCTCAGTCACACAAAGAGTAAAGAAGAACAA&Field_SequenceName=Sequence+test&Field_SequenceDate=4.27&NbRecs=10&MatInspector=Search"
It seems that the Accept header is needed, but I don't know why.
Making the following changes to your code seems to work for me:
data = urllib.urlencode(params)
headers = {"Accept" : "*/*"}
req = urllib2.Request(url, data, headers)
print urllib2.urlopen(req).read()
Thanks a lot, it's working now! I capture the package sent by firefox4 with WireShark. The Accpet header is below:
Accept: text/html,application/xhtml+xml,application/xml;q=0.9,/;q=0.8
Would it be helpful to find out the reason?
I wouldn't worry about the reason too much, most likely a server setup that tries to ward off certain type of requests, props to Bio_X2Y for finding it out though - an error like this would that would have stumped me too for ages
Log in to answer this question.