This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Where Can I Download All Exons Of The Human Genome In Fasta Format (One Big File!) ?

Hi to all,

Where can I download all exons of the human genome in FASTA format (one big file!)?

Thanks

fasta human-genome exon

Thank you very much to all. Thank you Malachi, this is what I am looking for.

Not an answer... This should go as a comment. Thanks!

5 answers

Using Ensembl BioMART

  1. Go to BioMART website.
  2. Choose database: Ensembl Genes 70
  3. Choose dataset: Homo sapiens
  4. Click 'Attributes' then select the 'Sequences' option
  5. Expand the sequences pane and select the 'Exon sequences' option
  6. Expand the 'Header information' pane. Select the info you want to associate with each sequence record (e.g. Ensembl Gene ID, Ensembl Transcript ID, Ensembl Exon ID).
  7. Click the 'Results' button.
  8. Make sure the example output looks good, select the 'Compressed File' option and hit the 'Go' button.

The download took a while but eventually I got a file 'mart_export.txt.gz'. This file has output that looks like this

>ENSG00000264715|ENST00000578347|ENSE00002715610
AGGAGTGACCAGAAGACAAGAGTGCGAGCCTTCTGTTATGCCCAGACAGGGCCACCAGAGGGCTCCTTGGTCTAGTGGTAACGCCA 
>ENSG00000265161|ENST00000580394|ENSE00002716056
AGTAGAGATGGGGTTTCACCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAGGTGATCCATCCACC
>ENSG00000200917|ENST00000364047|ENSE00001438810
GCACATACATATACTAAAATTGGAACAATACAGAGAAGATTAGCATAGCCCCTGCGCAAGGATGACATGCAAATTCGTGAAGTGTTCCATATTAAA
...

Thank you Malachi, this is what I am looking for :)

Have a look at the UCSC Table Browser: position base query

The page does not work

Here - ftp://ftp.ebi.ac.uk/pub/databases/astd/current_release/human/

If anyone is looking for the same but for GRCh37 here is the link.

Log in to answer this question.