mirdeep2 v 10
I running mirdeep2 mapper.pl using this script:
/Users/sysadmin/desktop/mirdeep2-0.1.0/src/mapper.pl obese_miRNAseq_config.txt -d -e -h -i -j -k TGGAATTCTCGGGTGCCAAGG -l 18 -m -p ../hg19.ebwt/hg19 -q -s all_obese_miRNA_reads.fa -t all_obese_miRNA_reads_vs_hg19.arf -v
but i get a message: Cannot open FASTQ file supplied by option -e
Anybody with an idea what's going on?
• 2,514 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Output of
head all_obese_miRNA_reads.fa?No, this is not the out put file. I am running mapper.pl
I am first running mapper.pl, so I can generate the .fa output for the quantifier.pl
ATPoint asked for the output of a command, he was not referring to the fasta file as the output file.
It seems
-eexpects a fastq file, and you supplying none.Yeah, that is why it should be checked if the file is indeed fasta or just mis-suffixed.
I have fastq files compiled into a config.tx file. I have included option -d and -e
Below is the format for the fastq that I have:
Can you check the config.txt file?
It should be in the below format (make sure, you provide space in between fastq file and sample name)
what's the unix command to open fasta file?
Do not add an answer unless you're answering the top level question; Use the
Add CommentorAdd Replyoptions instead. I'm moving this to a comment.Please google "unix command to view file" and show us you've invested some effort.