Ok. I shall check it. Thank you so much.
• 1 views
•
link
Hi all,
Kindly help me with this issue
shanthi@shanthi-client2:~/Desktop/Nivya/Fastq files/SRR7189567-stage 1A$ mapper.pl trim_3_SRR7189567.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT -l 18 -m -p genome -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -v -n -h
parsing fastq to fasta format
discarding sequences with non-canonical letters
clipping 3' adapters
discarding short reads
collapsing reads
mapping reads to genome index
Could not locate a Bowtie index corresponding to basename "genome"
Please make sure you used bowtie version 1 to build the index.
Usual index files have suffix .ebwt
I have used bowtie version 1. But i dont know why this is occuring.
Thank You in advance
Is the genome index directory in your current path (~/) ? Otherwise you should had the absolut path of the genome index directory in your command line.
Log in to answer this question.
Please add the command you used to generate the genome index with bowtie 1
i used the command to generate bowtie files
Do you have a directory called genome with .ebwt files inside ?
Could you copy paste the log file of the bowtie-build command please
yes i do have genome directory with .ebwt files.. but there are no log files other than .ebwt files inside. but after doing the mapper.pl function there is a bowtie log file. Kindly check these files
Please make sure the index name which you have provided during bowtie-build is same as what you are providing after '-p' option.
Yes. i checked again. It is the same index name that i have provided after -p option.