Cant find bowtie index files
Hi all
I am new to NGS analysis. I am trying to attempt miRNA Seq analysis. But i have come across this problem. Could anyone help me? Thanks in advance.
mapper.pl trim_3_SRR7189569.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT -l 18 -m -p /home/nivya/Desktop/NSCLC/miRNASeq/genome/genome -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -v -n -h
parsing fastq to fasta format
discarding sequences with non-canonical letters
clipping 3' adapters
discarding short reads
collapsing reads
mapping reads to genome index
Could not locate a Bowtie index corresponding to basename "/home/nivya/Desktop/NSCLC/miRNASeq/genome/genome"
Please make sure you used bowtie version 1 to build the index.
Usual index files have suffix .ebwt
• 4,026 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Could you please provide the command line used to generate the index ? Did you use bowtie first version to index your genome ? Which files do you have in
/home/nivya/Desktop/NSCLC/miRNASeq/genome/?Sure Bastien
The command line used for generating the index is bowtie2-build genome.fa genome
I have genome.1.bt2, genome.2.bt2, genome.3.bt2, genome.4.bt2, genome.rev.1.bt2 and genome.rev.2.bt2 in /home/nivya/Desktop/NSCLC/miRNASeq/genome/ folder.
Thank you in advance.
It's written black and white :
You indexed your genome with bowtie2 :
bowtie2-buildBowtie first version generate index suffix files as
.ebwtwhile bowtie2 does not. You need to redo your index with bowtie first versionok i shall try installing bowtie 1 and do the indexing.
Hello nivya.james2016 ,
Please use the formatting bar (especially the

codeoption) to present your post better. I've done it for you this time.Thank you!