This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Cant find bowtie index files

Hi all

I am new to NGS analysis. I am trying to attempt miRNA Seq analysis. But i have come across this problem. Could anyone help me? Thanks in advance. 

mapper.pl trim_3_SRR7189569.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT  -l 18 -m -p /home/nivya/Desktop/NSCLC/miRNASeq/genome/genome -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -v -n -h

parsing fastq to fasta format
discarding sequences with non-canonical letters
clipping 3' adapters
discarding short reads
collapsing reads
mapping reads to genome index
Could not locate a Bowtie index corresponding to basename "/home/nivya/Desktop/NSCLC/miRNASeq/genome/genome"
Please make sure you used bowtie version 1 to build the index.
Usual index files have suffix .ebwt
software error mirnaseq
• 4,009 views • link
updated by finswimmer finswimmer • written by nivya.james2016 • nivya.james2016

Could you please provide the command line used to generate the index ? Did you use bowtie first version to index your genome ? Which files do you have in /home/nivya/Desktop/NSCLC/miRNASeq/genome/ ?

• 1 views • link
written by Bastien Hervé Bastien Hervé

Sure Bastien

The command line used for generating the index is bowtie2-build genome.fa genome

I have genome.1.bt2, genome.2.bt2, genome.3.bt2, genome.4.bt2, genome.rev.1.bt2 and genome.rev.2.bt2 in /home/nivya/Desktop/NSCLC/miRNASeq/genome/ folder.

Thank you in advance.

• 1 views • link
written by nivya.james2016 • nivya.james2016

It's written black and white :

Please make sure you used bowtie version 1 to build the index. Usual index files have suffix .ebwt

You indexed your genome with bowtie2 : bowtie2-build

Bowtie first version generate index suffix files as .ebwt while bowtie2 does not. You need to redo your index with bowtie first version

• 1 views • link
written by Bastien Hervé Bastien Hervé

ok i shall try installing bowtie 1 and do the indexing.

• 1 views • link
written by nivya.james2016 • nivya.james2016

Hello nivya.james2016 ,

Please use the formatting bar (especially the code option) to present your post better. I've done it for you this time.
code_formatting

Thank you!

• 1 views • link
written by finswimmer finswimmer

0 answers

No answers yet.

Log in to answer this question.

More posts like this