This is a test version of Biostars. For the public version, visit https://www.biostars.org.
mirdeep2 mapper.pl generates empty arf folder while .fa folder has data

I use the this command line to run mapper.pl:

/Users/sysadmin/desktop/mirdeep2-0.1.0/src/mapper.pl study/miRNAseq-config_trim2.txt -d -e -h -i -j -m -p genome/hg19 -q -s miRNA_reads_Trim2.fa -t miRNA_reads_vs_hg19.arf -v

At the end of running all files, I get these messages:

#desc   total   mapped  unmapped    %mapped %unmapped
Use of uninitialized value $count2 in subtraction (-) at /Users/sysadmin/desktop/mirdeep2-0.1.0/src/mapper.pl line 731.
total: 26314065 Use of uninitialized value $count2 in print at /Users/sysadmin/desktop/mirdeep2-0.1.0/src/mapper.pl line 731.
    26314065    Use of uninitialized value $count2 in division (/) at /Users/sysadmin/desktop/mirdeep2-0.1.0/src/mapper.pl line 732.
Use of uninitialized value $count2 in division (/) at /Users/sysadmin/desktop/mirdeep2-0.1.0/src/mapper.pl line 732.
0.000   1.000

This is an example of message in mapper log:

parsing fastq to fasta format
fastq2fasta.pl study/sRNA_99_S99_R1_001_trim2.fastq > dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/reads.fa
converting rna to dna alphabet
rna2dna.pl dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/reads.fa > dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/reads_dna.fa
discarding sequences with non-canonical letters
fastaparse.pl dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/reads_dna.fa -b > dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/reads_letters.fa 2>dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/reads_discarded.fa
discarding short reads
fastaparse.pl dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/reads_letters.fa -a 18 > dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/reads_no_short.fa 2>dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/reads_too_short
collapsing reads
collapse_reads_md.pl dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/reads_no_short.fa 188 > dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/reads_nr.fa
mapping reads to genome index
bowtie -p 1 -f -n 1 -e 80 -l 18 -a -m 5 --best --strata genome/hg19  --al dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/sRNA_99_S99_R1_001_trim2.fastq_mapped --un dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/sRNA_99_S99_R1_001_trim2.fastq_not_mapped  dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/reads_nr.fa dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/mappings.bwt 2>bowtie.log

convert_bowtie_output.pl dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/mappings.bwt > dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/mappings.arf
trimming unmapped nts in the 3' ends
parse_mappings.pl dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/mappings.arf -j > dir_mapper_188_sRNA_99_S99_R1_001_trim2.fastq_1479928259_22_12_2023_t_11_21_48/mappings_trim.arf
mapper.pl mirdeep2
• 1,293 views • link
updated by Ram Ram • written by gkarere • gkarere

The error is after running python3.12 cutadapt

• 0 views • link
written by gkarere • gkarere

You have been warned not to add answers when you're not actually answering and to use the forum properly. Invest some effort into learning.

• 0 views • link
written by Ram Ram

I finally got the mirdeep2-0.1.3 installed successfully in Mac computer (Sonoma 14.2.1).

I run this mapping script:

/Users/sysadmin/desktop/mirdeep2-0.1.3/src/mapper.pl \
  pepper_somma_study/miRNAseq-config_trim2.txt \
  -d -e -h -i -j -m \
  -p genome/hg19 \
  -q \
  -s miRNA_reads_Trim2.fa \
  -t miRNA_reads_vs_hg19_Trim2.arf \
  -v

First I get this message:

grep: /proc/cpuinfo: No such file or directory.

Then, this run:

handling file 'pepper_somma_study/sRNA_01_S1_R1_001_trim2.fastq' with prefix '001'
parsing fastq to fasta format
converting rna to dna alphabet
discarding sequences with non-canonical letters
discarding short reads
collapsing reads
mapping reads to genome index
usage: /Users/sysadmin/Downloads/mirdeep2-0.1.3/bin/convert_bowtie_output.pl reads_mapped.bwt
trimming unmapped nts in the 3' ends

Results: the "arf" folder has zero bytes and "fa" folder has 250MB of data. Statistics shows no mapping was done.

Does anyone know why arf folder is zero after the run and what I can do?

• 0 views • link
updated by Ram Ram • written by gkarere • gkarere

0 answers

No answers yet.

Log in to answer this question.

More posts like this
  • mapper.pl gives empty output
    written by Bane • Bane
    I have 2 paired end RNA-Seq data and i need to find miRNAs therefore i am using miRDeep2. I installed the miRDeep2 through conda (could …
  • mirdeep2 v 10
    written by mugambigenes90 • mugambigenes90
    I running mirdeep2 mapper.pl using this script: /Users/sysadmin/desktop/mirdeep2-0.1.0/src/mapper.pl obese_miRNAseq_config.txt -d -e -h -i -j -k TGGAATTCTCGGGTGCCAAGG -l 18 -m -p ../hg19.ebwt/hg19 -q -s all_obese_miRNA_reads.fa -t …
  • error in mapper script in miRDeep2
    written by nivya.james2016 • nivya.james2016
    Hi all I'm used the following mapper script for miRNA alignment in miRdeep2. I am getting error and also the reads_vs_genome.arf is empty. I am …