mapper.pl gives empty output
I have 2 paired end RNA-Seq data and i need to find miRNAs therefore i am using miRDeep2. I installed the miRDeep2 through conda (could not make manual installation). First i am making my index through bowtie by
bowtie-build GCA_018258275.1_ASM1825827v1_genomic.fna index_file
Then i am starting the mapper.pl by
mapper.pl SRR1687231_1.fastq -e -h -i -j -k AGATCGGAAGAG -l 21 -m -p index_file -s R_collapsed.fa -t R_refdb.arf -v -o 4
But i consistently getting this result
parsing fastq to fasta format
converting rna to dna alphabet
discarding sequences with non-canonical letters
clipping 3' adapters
discarding short reads
collapsing reads
Killed
mapping reads to genome index
trimming unmapped nts in the 3' ends
Log file for this run is in mapper_logs and called mapper.log_8642
Mapping statistics
#desc total mapped unmapped %mapped %unmapped
total: 0 0 0 Illegal division by zero at /home/bane/anaconda3/bin/mapper.pl line 737.
This is my mapper.log
current dir: /home/bane/Desktop/Mine_1200TL/miRdeep2
mapper command: /home/bane/anaconda3/bin/mapper.pl 31_1.fastq -e -h -i -j -k GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC -l 21 -m -p index -s R_collapsed.fa -t R_refdb.arf -v -o 4
timestamp: 16_07_2021_t_21_16_08
parsing fastq to fasta format
fastq2fasta.pl 31_1.fastq > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads.fa
converting rna to dna alphabet
rna2dna.pl dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads.fa > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_dna.fa
discarding sequences with non-canonical letters
fastaparse.pl dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_dna.fa -b > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_letters.fa 2>dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_discarded.fa
clipping 3' adapters
clip_adapters.pl dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_letters.fa GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_clip.fa
discarding short reads
fastaparse.pl dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_clip.fa -a 21 > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_no_short.fa 2>dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_too_short
collapsing reads
collapse_reads_md.pl dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_no_short.fa seq > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_nr.fa
mapping reads to genome index
bowtie -p 4 -f -n 0 -e 80 -l 18 -a -m 5 --best --strata index --al dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/31_1.fastq_mapped --un dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/31_1.fastq_not_mapped dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_nr.fa dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/mappings.bwt 2>bowtie.log
convert_bowtie_output.pl dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/mappings.bwt > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/mappings.arf
trimming unmapped nts in the 3' ends
parse_mappings.pl dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/mappings.arf -j > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/mappings_trim.arf
remove tmp dir
rmtree(dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08)
############################################################
I can not figure out the problem. Can anyone help me with this problem? By the way this is my first attempt of miRNA
• 2,927 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Why don't you ask on their GitHub-page
To be honest i did not know that was an option and i just checked their GitHub-page and Drmirdeep (contributor of the tool) seems a bit angry and offensive to the people who asks questions.
Well i will try my chance anyway
Did you run one of the tutorials? Just to be sure that is not an installation poblem
actually it did not. the tool has to create a result.html file but it simply didnt. bowtie results seems fine though. when i try my bowtie has %0 allignment but this one has %56. I dont know what is wrong with the tool
i just ran the tutorial again with different files and it worked perfectly. I think the problem related with bowtie. I am creating the index file with bowtie version 1.0 and running the mapper.pl with the same bowtie (i mean i suppose it is the same because conda installed everything just with mirdeep2) but it does not allign anything
Why do you think they are being offensive?