This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Why is mapper.pl from mirdeep2 producing an empty mapping file?

Hello All,

I am new to mirna analysis and using mirdeep2 for alignment and quantification of miRNA. The miRNA was developed using the true kit from Illumina. I've used the mapper.pl program to perform adapter removed using command1. I made the index to the reference using bowtie_v_1.2 using command2. Now, I am trying to create a mapping file using mapper.pl, the script runs successfully but the mapping file is empty [command3]. Can you please provide comments as to where my I am making a mistake? Appreciate all your help.

Thanks 

command1: mapper.pl ../RawData.fq -e -h -i -j -k TGGAATTCTCGGGTGCCAAGG -l 18 -m -s reads_collapsed.fa

command2: bowtie-build genome/GRCh38.p13.genome.fa.gz  GRCh38.p13

command3: mapper.pl reads_collapsed.fa -c -p GRCh38.p13 -t reads_collapsed_vs_genome.arf
mirna ngs next-gen
• 2,566 views • link
updated by Yuquan • Yuquan • written by halo22 halo22

Try combining command 1 and 3, run command 2 first:

bowtie-build genome/GRCh38.fa GRCh38_idx

mapper.pl ../RawData.fq -e -h -i -j -k TGGAATTCTCGGGTGCCAAGG  -l 18 -m -p GRCh38_idx -s reads_collapsed.fa -t reads_vs_genome.arf -v

Does bowtie make correct indices from a fa.gz file? Maybe you have to gunzip it.

Be sure to add -v to assess the run output.

• 0 views • link
written by Barry Digby Barry Digby

1 answer

Hi,

As Barry said, make sure you have the index file ready (from command 2) and then run command 1 and 3 together.

Another reason might be you set -l 18 in your command 2, meaning you are discarding any reads with length < 18. Did you check your read length distribution to make sure this cutoff is appropriate for your data? You can run fastqc to quickly check the length distribution after removing adapters.

• 0 views • link
written by Yuquan • Yuquan

Log in to answer this question.

More posts like this