but I explained all story, fastx_nucleotide_distribution_graph.sh just take TXT out put file of fastx_quality_stats as input, with one txt input file fastx_nucleotide_distribution_graph.sh works well but with two input file( -i file1.txt file2.txt) I got this error:
gnuplot> set term png size 1048,768
^
line 0: unknown or ambiguous terminal type; type just 'set terminal' for a list
WARNING: Plotting with an 'unknown' terminal.
It's illumina fq files, could you introduce other scripts ?
it's works without any problem with -i file1.text , and I have a nice plot in out put , problem is fastx_nucleotide_distribution_graph.sh is not compatible with more than one input file. so I should find other alternative scripts for merge nucleotide_distribution_graph from distinct fq file.
I think to a awk code to have a sequence length frequency in each fq file and then merge them in Excel to have a unique sequence length graph with different color for each lib.
I have two FASTQ data sets/files (read.R1.fastq and read.R2.fastq) generated from paired-end read sequencing. One file (read.R1.fastq) contains 18 nucleotide long linker/tag. How can I …
Hello, I have two Illumina fastq files (read 1 and read 2) that contain reads from three different frameworks. Each framework has a different sequence …
Hello, Do you have any idea about How to get proportion of specific sequence (defined as a separate fastq file= ``` @1 TAACCCTAACCCTAACCCTAACCC + JJJJJJJJJJJJJJJJJJJJJJJJ …
what have you tried/found so far ?
fastx-tool kit but it just for one lib and I want merge all lib data in one geraph
what about merging the fastq files before running fastx ?
I don't want merge all reads , just want show sequence length of multi fq file , separately (for instance according color ) in one graph
http://hannonlab.cshl.edu/fastx_toolkit/commandline.html
I think you should consider this option.
should use output of fastx_quality_stats , as input for FASTA/Q Nucleotide Distribution
, so is it a right command ?
No harm is trying the command out :)
I think it should be something like
This is probably about Illumina data, but it never hurts to mention this!
above commands not work , except hurts and harm topic fast reply! could you help to find a way ?
You didn't tell us where you got the data from. So, Illumina data?
You'll have to tell us a bit more about how those don't work.
above commands not work
but I explained all story, fastx_nucleotide_distribution_graph.sh just take TXT out put file of fastx_quality_stats as input, with one txt input file fastx_nucleotide_distribution_graph.sh works well but with two input file( -i file1.txt file2.txt) I got this error:
It's illumina fq files, could you introduce other scripts ?
Anything wrong with FastQC?
no all thing is OK with FASTQC , I can post only 5 post per 6hr, is there any way to improve it ?
After you have been on Biostars for a while this restriction will be removed.
fastx calls gnuplot ; it seems that your version is not complete:
https://stackoverflow.com/questions/22816030
it's works without any problem with -i file1.text , and I have a nice plot in out put , problem is fastx_nucleotide_distribution_graph.sh is not compatible with more than one input file. so I should find other alternative scripts for merge nucleotide_distribution_graph from distinct fq file.
If you need just one plot for the entire dataset then cat'ing the fastq files together to generate one inout (per read, R1/R2) may be the way to go.
I think to a awk code to have a sequence length frequency in each fq file and then merge them in Excel to have a unique sequence length graph with different color for each lib.