Hello everyone, I am analyzing some published dataset. I runner fastqc to check the data quality first. The fastQC reports suggested that the overrepresented sequences seem to be the sequencing index. But I checked the sequencing for the index it indicated but they didn't match. Here is the overrepresented sequences the fastQC reported. AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGATCTCGTATG And it gave me a possible source, TruSeq Adapter, Index 22 (97% over 49bp). I checked the sequences for index 22 online and it is 5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGTAATCTCGTATGCCGTCTTCTGCTTG
They didn't match. So my question is that whether I should trim the second sequences or trim the overrepresented sequences fastQC reported. How can I be sure I trim the right sequences? Thank you very much.
0 answers
No answers yet.
Log in to answer this question.
-
How to find the adapter sequence of an RNAseq dataset?
written by Maryam •
-
Removing overrepresented sequences in paired end RNA-seq
written by LayneSadler
-
TruSeq Illumina adapters are BLASTed with a high confidence to some genes/terms
written by e.r.zakiev •
-
Which adapters to use for trimming?
written by whb •
-
Removing Illumina Single End PCR Primers and TruSeq Adapters
written by serpalma.v •
-
Correct Trimmomatic adapter sequence file to use?
written by gbatzel •
-
FastQC report: Why no error in 'Adapter content' and which sequences of 'Overrepresented sequences'…
written by salamandra
-
trim adaptors RNA-seq
written by sophialovechan •
-
Trimming Overrepresented Sequences in paired-end RNA-Seq data, as underlined by FastQC.
written by Shaurya Jauhari •
-
Possible adapter on the forward sequence,
written by fkm.022 •
