Please use ADD COMMENT/ADD REPLY when responding to existing posts to keep threads logically organized.

Try this:

formatdb -i Cat19_prot.fasta -o T -p T

it produces 6 indexes, then;

blastp -query your_query.faa -db Cat19_prot.fasta -evalue 1e-5.... etc etc etc...

I had an excel sheet with 3 columns: consecutive number, name of gene, sequence therefore I copied everything into a text editor and replaced all tabs with underscore, all slashes/colons with underscore etc and added a bigger than sign to the beginning, so this:

>1.gene
atgttgcaagagaaagtaaagccaatagaagaaacactcgaccccgaggattgggaatccatgcgggcactcggtcatcggatggttgacgacatgttaacatacctacggaatgtacgatccgaaccatcaggttctcccacccaaaaagccatcgaggatatttgcgttcctcttacacacgacggggaaggcgaagagaaagtttacgaggtattccaacatagtattctcccttatacgttttcaatcacgaggcctcggttttggggactagttgccggaaccggctccccatatgggatgttcgctgagatgctaagagcgggtatgaacagttgccaagaaagccttttcgcagaagcatatgtccacaagcaggtaatcggctggattaaggagatggtcgacttccccgaagaggctggcggagtactcgtaagcggtggctcagaggctaatttcaccggattagccgttgctcgaaataca

so it should be formatted as a fasta file

I also performed all search+replace commands with two other files of the same structure and there were no problems with the makeblastdb command