This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Makeblast error when Nucleotide sequence contanis 'X" character

hi, i catch a error when used makeblastdb commd for make blast db, the issur as below: 

New DB title:  nucl_patent_01
Sequence type: Nucleotide
Keep MBits: T
Maximum file size: 1000000000B
FASTA-Reader: Ignoring invalid residues at position(s): On line 34764876: 2

when i sed the line 34764876, and i find there has a 'X' character in the pos of this line, Nucleotide sequence is GXACCTGATGTAGCAGACAGTCTC, what should i do if i want make this Nucleotide sequence into my blast db? the blast version is blast 2.7.1， makeblastcmd is : 

makeblastdb -in part-r-00000 -dbtype nucl -title nucl_patent_01 -out /blast_db/nucl_patent_01
sequence
• 2,321 views • link
updated by lakhujanivijay lakhujanivijay • written by zhouyunping • zhouyunping

Replacing X with N. This should work.

seqkit replace -i -s -p X -r N in.fa.gz -o out.fa.gz
• 1 views • link
written by shenwei356 shenwei356

1 answer

You can change the X to a N with something like this:

sed -i '/^>/! s/X/N/g' inputfasta.fa
• 1 views • link
written by gb gb

Log in to answer this question.

More posts like this