BLAST Database creation error: is not a valid local ID

I tried to create blast database for my fasta file:

>ban-mir-276
agcgagguauagaguuccuacguaauacaugccuguaggaacuucauaccgugcucu
>ban-mir-9a
ucuuugguuaucuagcuguaugaguacucagacaucauaaagcuagguuaccggaguua
>ban-bantam
cugguuuucauaaugauuugacagauuguuccauauucugagaucauugugaaagcugau
>ban-mir-279b
aagggguuuaaaucuaguagcacaguguucaccugugacuagaucuacacucauuga

using command:

makeblastdb -in hairpin_name.fa -dbtype nucl -out hairpin_name -parse_seqids

An error message pops up:

Building a new DB, current time: 05/15/2020 20:26:49
New DB name:   /media/nus/AMLab_Ext1/Shen/miR_anno/rm_redundancy/hairpin_name
New DB title:  hairpin_name.fa
Sequence type: Nucleotide
Keep MBits: T
Maximum file size: 1000000000B

No volumes were created.

BLAST Database creation error: 'ban-mir-276' is not a valid local ID

blast rna-seq database software error alignment

• 1,902 views • link

written 6.2 years ago by tianshenbio

1 answer

When I copy paste your example above I see an extra ? in >?ban-mir-276. If I take that out database builds fine.

>?ban-mir-276
agcgagguauagaguuccuacguaauacaugccuguaggaacuucauaccgugcucu

• 0 views • link

written 6.2 years ago by GenoMax

Em...But there is no such ? in my original file

• 0 views • link

written 6.2 years ago by tianshenbio

Perhaps there is a character that is not visible. Edit that line and type it in and see if that fixes things.

• 0 views • link

written 6.2 years ago by GenoMax

Thank you so much. The problem is solved. Not sure how the invisible thing is introduced...

• 0 views • link

written 6.2 years ago by tianshenbio

More posts like this

makeblastdb Bus error
written 5.0 years ago by 860101959 •

Problem: ``` $makeblastdb -in $reference -parse_seqids -title "hg19" -dbtype nucl Building a new DB, current time: 08/16/2021 14:21:54 New DB name: New DB title: hg19 …
I get this error while creating database on BLAST: BLAST Database creation error: mdb_env_open: Inp…
written 6.1 years ago by oncelmiran6 •

I am trying to do blastp for a research project this is my code: >`$ makeblastdb -in refseqlassa.fasta -parse_seqids -out lassadbv2 -dbtype prot` After I …
BLAST+ error: No alias or index file found for nucleotide database
written 8.2 years ago by Nottuh •

Hi, I'm trying to run tblastn, but whatever I try, I always get back the following error: BLAST Database error: No alias or index file …
makeblastdb doesn't create database output
written 9.2 years ago by m.rhodes •

I am using *makeblastdb* to create a database of fungal ITS sequence. When I run the command: ./makeblastdb -in uniteits.fasta -out UNITE_ITS.fasta -dbtype nucl -parse_seqids …
creating a blast database
written 10.0 years ago by sukesh1411 •

Hi I downloaded the nr.gz file from blast ftp link. nr folder has 44 tar.gz files. I could not make a blast database using this …
BLAST options error (input format type error) in makeblastdb
written 10.1 years ago by 2013302630028 •

When I use `makeblastdb` command to build a protein database by using a fasta file, it is ok. But when combined this fasta file together …
How to make a custom blast db with taxon IDs from a taxid_map file
written 10.1 years ago by rwn

Dear all, I'm attempting to create a custom BLAST database from a dozen or so whole genomes. For downstream analyses it's necessary to have the …
Makeblastdb error: file does not exist
written 11.6 years ago by coreyhowe99 •

Bioinformatics noob here, I just downloaded the blast command line applications and I would like to make a database of a transcriptome that I have …
Strange "Error: OID not found" in NCBI's blastdbcmd
written 11.6 years ago by juanma_lace •

I'm getting a OID not found when executing `blastdbcmd`. My file is as follows: ``` cat data/4D/4ds_newbler2.6_shotgun_lmp_scaffolds.fasta.splitted | grep scaffold00001_37_1_21 >scaffold00001_37_1_21 ``` And I run …
Makeblastdb Can'T Find My Fasta Files
written 13.1 years ago by Catie Adair •

<p>I'm trying to make a nucleotide database for my sequences. After opening <code>C:Program Files\NCBI\blast-2.2.28+></code> in the command line, I typed in </p> <pre><code>makeblastdb -in test_gene.fsa …