makeblastdb Bus error

Problem:

$makeblastdb -in $reference  -parse_seqids -title "hg19"  -dbtype nucl

Building a new DB, current time: 08/16/2021 14:21:54
New DB name:   
New DB title:  hg19
Sequence type: Nucleotide
Deleted existing Nucleotide BLAST database named 
Keep MBits: T
Maximum file size: 1000000000B
Bus error

Version:

$makeblastdb -version
makeblastdb: 2.11.0+

But I found command such as blastn work fine..., thanks for your advice!

bus-error blast

• 2,381 views • link

updated 2.1 years ago by Ram

• written 5.0 years ago by 860101959 •

Did you try Googling this? SeqA has a thread on this: http://seqanswers.com/forums/showthread.php?t=61274

• 0 views • link

written 5.0 years ago by Ram

0 answers

No answers yet.

More posts like this

Blast database built error
written 4.7 years ago by Ap1438 •

makeblastdb -in nt -dbtype nucl -out nt Building a new DB, current time: 12/09/2021 15:55:27 New DB name: /home/internal/Databases/NT/NT_Jul2021/nt New DB title: nt Sequence type: …
BLAST Database creation error: is not a valid local ID
written 6.2 years ago by tianshenbio

I tried to create blast database for my fasta file: >ban-mir-276 agcgagguauagaguuccuacguaauacaugccuguaggaacuucauaccgugcucu >ban-mir-9a ucuuugguuaucuagcuguaugaguacucagacaucauaaagcuagguuaccggaguua >ban-bantam cugguuuucauaaugauuugacagauuguuccauauucugagaucauugugaaagcugau >ban-mir-279b aagggguuuaaaucuaguagcacaguguucaccugugacuagaucuacacucauuga using command: makeblastdb -in hairpin_name.fa -dbtype nucl …
cannot make BLAST database using makeblastdb command line tool
written 6.7 years ago by b10hazard •

I'm trying to build a custom database using makeblastdb command line tool from a large fasta file (about 3.0 GB in size). Here is my …
Blastn error, database creation problem, BLAST
written 8.9 years ago by biomagician

Hi, I am trying to blast contigs to the C. elegans reference genome sequence with the following 2 commands: makeblastdb -in celegans.fa -input_type fasta -dbtype …
makeblastdb doesn't create database output
written 9.2 years ago by m.rhodes •

I am using *makeblastdb* to create a database of fungal ITS sequence. When I run the command: ./makeblastdb -in uniteits.fasta -out UNITE_ITS.fasta -dbtype nucl -parse_seqids …
creating a blast database
written 10.0 years ago by sukesh1411 •

Hi I downloaded the nr.gz file from blast ftp link. nr folder has 44 tar.gz files. I could not make a blast database using this …
BLAST options error (input format type error) in makeblastdb
written 10.1 years ago by 2013302630028 •

When I use `makeblastdb` command to build a protein database by using a fasta file, it is ok. But when combined this fasta file together …
Strange "Error: OID not found" in NCBI's blastdbcmd
written 11.6 years ago by juanma_lace •

I'm getting a OID not found when executing `blastdbcmd`. My file is as follows: ``` cat data/4D/4ds_newbler2.6_shotgun_lmp_scaffolds.fasta.splitted | grep scaffold00001_37_1_21 >scaffold00001_37_1_21 ``` And I run …
Why Do I Get A Makeblastdb Error: File Does Not Match Input Format Type, Default Input Type Is Fasta
written 12.7 years ago by alok.helix

Hello guys, After giving the following command I am facing error for the output file being generated. However formatdb was able to accept my FASTA …
Makeblastdb Can'T Find My Fasta Files
written 13.1 years ago by Catie Adair •

<p>I'm trying to make a nucleotide database for my sequences. After opening <code>C:Program Files\NCBI\blast-2.2.28+></code> in the command line, I typed in </p> <pre><code>makeblastdb -in test_gene.fsa …