This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Can't open gz file

Hi,

I just received this gz file:

---Link removed by WouterDeCoster, see comment below---

I can't open it on my Windows PC. If you can open it, please teach me how to.

Elgin

fastq

Hi, is this your individual with the uncharacterized genomic features? Do you want to expose the sequences to everyone? Apart from that you can use 7zip on windows.

This is not a tar archive. Btw, a lot of tools can open fastq.gz directly. If you upload the file to Galaxy, it should also be extracted automatically.

7zip will uncompress the gz file, and also untar the resulting file as well

Your file looks good to me :)

Johns-MacBook:~ John$ curl -s https://data.macrogen.com/~macro2/HiSeqX/201608/1608KHP-0049/sample_R1.fastq.gz | zcat | head
@MG00HS16:1088:H2FNMBCXY:1:1101:5883:1990 1:N:0:TAAGGCGA
NCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGCGGGATGGAGGCCTTCGGGTTGTAAACCGCTTTTG
+
#BDDIIIIIIGIIIIIIIIIIIIIIIIIIIIIIIIIIGIHIIIIIIIIIIIIIIIGHIIIIIIIIHIIIDHIIGHHHHIIIHIIIIIIIIIIIIGHIIIH
@MG00HS16:1088:H2FNMBCXY:1:1101:5806:1999 1:N:0:TAAGGCGA
NTCCTGACGCATCCCTCTGACAAATTGTAAGCGGCAGTTGGAACATGGCTTCACCAATATGATCTCCAAGGCAAAGCATCATGAAAGCGATGGCTACCAAG
+
#DDDIIIIIIIIIIIIIIHIIIIIIIIIHIIDHIIIHHIIIIIIIIHIIIIIIIIIIIIIIIHHIIHIIIIIIIIIIIIIIIIIHHHHIIIIIIIHIHIH
@MG00HS16:1088:H2FNMBCXY:1:1101:9995:2000 1:N:0:TAAGGCGA
NCATTAAGAGTTGTCGGGAGGCAAAATAATGATATAAACAGAATTTACTCCATCATGCTCTTCAGAAGATACTTAGCAGTGGCCAGCTCTGTGGCAAAACA

John, this doesn't look like it answers OP's question (How to uncompress on a Windows machine). I'm moving this to a comment.

Quite right, sorry - I was only intending to show the file was not corrupt or tar'd

Actually, the commands may also be useful on a Windows machine, for instance running MobaXterm.

Is the actual question how to open the file or what to do with it? Frequently, when someone asks how to open a fastq.gz, they expect to find a spreadsheet with the analyzed results. It's very rare that someone actually wants to open a raw FASTQ. It's essentially useless without performing some analysis and and most tools that require a FASTQ input will accept a gzipped one.

Yes. Winter is coming.

Hope you had the permission for (or had thought about) posting a link for someone's genomic data in a public forum.

I assume this is connected with a request for assistance you posted elsewhere on the forum. The person who the data belongs to may not appreciate full consequences of making such data available publicly.

I realize I'm late to join this party, but I deleted the link in OPs post because I'm really doubting he should be sharing this data publicly online. Likely confidential, possibly privacy issue. Should discuss with his PI whether this is appopriate.

John already showed the file isn't corrupt so having the exact link here is no longer an added value.

If someone disagrees, let me know. Maybe OP isn't in a very competitive field (like I'm in) and this is all a bit an exaggerated reaction from my side.

1 answer

http://www.7-zip.org/download.html

Log in to answer this question.