Hi, is this your individual with the uncharacterized genomic features? Do you want to expose the sequences to everyone? Apart from that you can use 7zip on windows.

7zip is not enough. This is two-stage process.

See this link:

http://superuser.com/questions/215629/how-to-open-a-tar-gz-file-in-windows

Your file looks good to me :)

Johns-MacBook:~ John$ curl -s https://data.macrogen.com/~macro2/HiSeqX/201608/1608KHP-0049/sample_R1.fastq.gz | zcat | head
@MG00HS16:1088:H2FNMBCXY:1:1101:5883:1990 1:N:0:TAAGGCGA
NCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGCGGGATGGAGGCCTTCGGGTTGTAAACCGCTTTTG
+
#BDDIIIIIIGIIIIIIIIIIIIIIIIIIIIIIIIIIGIHIIIIIIIIIIIIIIIGHIIIIIIIIHIIIDHIIGHHHHIIIHIIIIIIIIIIIIGHIIIH
@MG00HS16:1088:H2FNMBCXY:1:1101:5806:1999 1:N:0:TAAGGCGA
NTCCTGACGCATCCCTCTGACAAATTGTAAGCGGCAGTTGGAACATGGCTTCACCAATATGATCTCCAAGGCAAAGCATCATGAAAGCGATGGCTACCAAG
+
#DDDIIIIIIIIIIIIIIHIIIIIIIIIHIIDHIIIHHIIIIIIIIHIIIIIIIIIIIIIIIHHIIHIIIIIIIIIIIIIIIIIHHHHIIIIIIIHIHIH
@MG00HS16:1088:H2FNMBCXY:1:1101:9995:2000 1:N:0:TAAGGCGA
NCATTAAGAGTTGTCGGGAGGCAAAATAATGATATAAACAGAATTTACTCCATCATGCTCTTCAGAAGATACTTAGCAGTGGCCAGCTCTGTGGCAAAACA

Is the actual question how to open the file or what to do with it? Frequently, when someone asks how to open a fastq.gz, they expect to find a spreadsheet with the analyzed results. It's very rare that someone actually wants to open a raw FASTQ. It's essentially useless without performing some analysis and and most tools that require a FASTQ input will accept a gzipped one.

Hope you had the permission for (or had thought about) posting a link for someone's genomic data in a public forum.

I assume this is connected with a request for assistance you posted elsewhere on the forum. The person who the data belongs to may not appreciate full consequences of making such data available publicly.

I realize I'm late to join this party, but I deleted the link in OPs post because I'm really doubting he should be sharing this data publicly online. Likely confidential, possibly privacy issue. Should discuss with his PI whether this is appopriate.

John already showed the file isn't corrupt so having the exact link here is no longer an added value.

If someone disagrees, let me know. Maybe OP isn't in a very competitive field (like I'm in) and this is all a bit an exaggerated reaction from my side.