This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Mirdeep2 Error: FASTA reads file is not in accordance with the fasta format specifications

Hi All,

I get this error from while running mirdeep2. I have tried two data sets and the same error results. It says:

First line of FASTA reads file is not in accordance with the fasta format specifications
Please make sure your file is in accordance with the fasta format specifications and does not contain whitespace in IDs or sequences

***** Please check if the option you used (options c) designates the correct format of the supplied reads file earthwormShort1.fa *****

I ran a perl code to delete whitespaces. I also tried this same data sets on other tools like sRNAbench and I had no error. Do I need to tweak the fasta file in a particular way for mirdeep2 to work with it?

Thanks!

rna-seq software-error

You should post the first line of the FASTA file.

Here is a few line from the fasta file. I believe Mirdeep wants it formatted in a some kind of format...

>cel1_count=3
TGCCTTGTCTGTCCTAAAAATC
>cel2_count=9
GTTAAGTGGGAAACGATGT
>cel3_count=7
CCGACCTTGAAATACCAC
>cel4_count=7
TAGAAATCCACTATGCTTTGG
>cel5_count=5
CGCGGGTGAGCAGCCTGGTAGCTCGTC
>cel6_count=3
TCCTGTTTTGTAATCGGCTGCA
>cel7_count=4
TACCACGTCCAAGGAAGGC
>cel8_count=3
GGCCGCGTGGCCTAATGGATAAGG

Kindly note that the first header line is not indented as shown. I cant tell why this note editor indents it after I hit submit.

2 answers

$ dos2unix reads.fa

sovled my problem!

This solved my problem too. the problem is the trailing ^M at each line of the file (you can see it using cat -v file.fa | head). The ^M is a carriage-return character which originates from windows. dos2unix replaces it with a single newline. it can be installed using apt-get install dos2unix

You should look at the file format description in the documentation. It looks like the mapper.pl script expects the FASTA identifiers to contain two underscores which delimit three fields such as:

>PAN_123456_x969696
ATACAATCTACTGTCTTTCCT

Thanks for your response, but then, how can we change our .fa files to fit the mirdeep2 description?

Log in to answer this question.