This is a test version of Biostars. For the public version, visit https://www.biostars.org.
miRDeep2 whitespaces error

Hi everyone,

I am trying to run miRDeep2.pl and I keep getting the following error message: 

#Starting miRDeep2
Error: miRNA reference this species file miRBase_ame.fa has not allowed whitespaces in its first identifier

As far as I can tell, it doesn't have any white spaces in its first identifier. The first line of the file looks like this

>ame_miR_3736

I've checked manually by opening in notepad and there isn't a whitespace hanging around at the end of the line - I also ran a script to remove any just in case. It looks exactly the same as the .fa file given in the miRDeep2 tutorial

>cel-miR-36

except that I have underscores instead of hyphens. If I change it to hyphens I get exactly the same error message.

Any suggestions?

If I don't input a known miRNA ref file it runs OK.

next-gen mirdeep2
• 4,173 views • link
updated by timothy.delory • timothy.delory • written by alysonashe • alysonashe

try dos2unix miRBase_ame.fa

• 0 views • link
written by shenwei356 shenwei356

I have encountered to the same problem for this code:

dos2unix GRCh38_primary_assembly_genomeCopy.fasta

I run dos2unix.However, I could not solve it via dos2unix. This is the error code I received:

dos2unix: Failed to change the owner and group of temporary output file ./d2utmpVftysK: Operation not permitted dos2unix: dos2unix: problems converting file GRCh38_primary_assembly_genomeCopy.fasta

Then I changed my fasta file. I used ucsc.hg19.fasta instead (for both indexing, mapping and mirdeep2 later). It worked without any whitespace error.

• 0 views • link
written by realnewbie • realnewbie

alysonashe, were you able to resolve this issue? I am in the same position. I have an input .fa which appears to have no white space in the file and am recieving the same error with miRDeep2.pl

I used sed -i 's/ //g' on the file to be sure. Here is the head of the .fa file:

>GL985793_7038
TGAGATCATTGTGAAAGCTGATT
>GL986159_20383
TGGAATGTAAAGAAGTATGGAG
>GL985803_8126
ATATTGTCCTGTCACAGCAGTAC
>GL985734_3508
TGAGATTCAACTCCTCCAACTT
>GL985752_4957
TGAGTATTAATTCAGGTACTGGT

Perhaps there is a formatting error I have made with the FASTA that I am unaware of?

Cheers,

Tim

• 0 views • link
written by timothy.delory • timothy.delory

0 answers

No answers yet.

Log in to answer this question.

More posts like this