This is a test version of Biostars. For the public version, visit https://www.biostars.org.
something about mirDeep2 error

I have some problem about the mirdeep2 but i don't know which step I was wrong. Can you tell me what is the problem about my sequence. Think you!

#Starting miRDeep2
/home/manager/miniconda3/bin/miRDeep2.pl 5223.fa mt.fna 5223.arf none none none

miRDeep2 started at 8:49:28

mkdir mirdeep_runs/run_27_02_2021_t_08_49_28

#testing input files
sanity_check_reads_ready_file.pl 5223.fa

started: 8:49:31
Error: problem with 5223.fa
Error in line 1.918.124: Either the sequence

ACGGTCTTACGTAGGACAACCGATGACGCTTq_11687569_x1
contains less than 17 characters or contains characters others than [acgtunACGTUN]

Please make sure that your file only comprises sequences that have at least 17 characters

containing letters [acgtunACGTUN]
software error

ACGGTCTTACGTAGGACAACCGATGACGCTTq_11687569_x1 contains less than 17 characters or contains characters others than [acgtunACGTUN]

The input file seems corrupted, mixing a header and a sequence.

0 answers

No answers yet.

Log in to answer this question.