Hello everyone!
I'm trying to run mirdeep2.pl
Command I use is following:
miRDeep2.pl reads_collapsed.fa Lusitatissimum_200_BGIv1.0.fa SRR8582417.arf none none none
1) reads_collapsed.fa file was created with SAM to ARF built-in mirdeep2 converter and has the following content:
>seq_1_x1
CTTATAGTGTAAGGTGGAATGAAG
>seq_2_x1
ATGTCACCGAGTCTGTTACGCAAT
>seq_3_x2
AGGGAAGAAGAACTAATATTTG
.......
2) Lusitatissimum_200_BGIv1.0.fa is my reference genome
3) SRR8582417.arf was generated with converter as well
miRDeep2 starts to run, but then it crashes with the error:
> #testing input files
> #testing input files sanity_check_reads_ready_file.pl reads_collapsed.fa
>
> started: 23:31:07 Error: problem with reads_collapsed.fa Error in line
> 434.802: Either the sequence contains less than 17 characters or contains characters others than [acgtunACGTUN]
>
> Please make sure that your file only comprises sequences that have at
> least 17 characters
>
> containing letters [acgtunACGTUN]
Both statements are false actually and alll files are in the working directory What's the problem?
•
written
by
LynxLynx •
Take a look at this tutorial A: mireap procedure short tutorial
You will need to split the fasta headers so that the collapsed read counts have a space separating the ID and count using sed
>seq_1_x1
CTTATAGTGTAAGGTGGAATGAAG
to
>seq_1_x 1
CTTATAGTGTAAGGTGGAATGAAG
Thank you! But there was a test file in mirdeep2/tutorial. I ran mirdeep with my files + this test file and it was ok.
>seq_0_x149538
TCACCGGGTGGAAACTAGCAGT
But this file has the same header' structure as mine. Why does it work?
sorry, I must have had it confused with mireap. are you sure the sequence lengths are all above 17? you might have to dig deeper into that.
awk '/^>/{if (l!="") print l; print; l=0; next}{l+=length($0)}END{print l}' test.fa > lenghts.txt
and parse output
I have removed all strings shorter than 18 with mapper.pl reads.fa -c -j -l 18 -m -s reads_collapsed.fa
Just to be sure I also removed all non-printable chrs using command line sed 's/[^[:print:]]//g' reads.fa > clean.fa
Did not help(
Then I just removed line 434.802, didn't help as well
By the way, the error is still in line 434.802 though I removed it
I just mapped reads again using mirdeep2 and obtained ARF file. So I didn't have to use converter :)
It worked? great! So the solution was to remake the arf file?
Hi,
How did you solve that problem?
My error is #testing input files
[1;31mError: [0mproblem with /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa
perl: warning: Setting locale failed.
perl: warning: Please check that your locale settings:
LANGUAGE = "en_IE:en",
LC_ALL = (unset),
LC_CTYPE = "UTF-8",
LANG = "en_IE.UTF-8"
are supported and installed on your system.
perl: warning: Falling back to a fallback locale ("en_IE.UTF-8").
But it didnot say what the problem is.
And my code is :miRDeep2.pl /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa /home/workspace/wangdi/cattle_miRNA/test/5_ref/bta.fa /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185.arf none none none -t Cow
In addition, when I use the bta_mature and bta_hairpin miRNA fasta file (generate from miRBase), the errer is "problem bta_mature.fa".
This really annoys me for weeks. Does anyone have idea about this?
Thanks a lot.
Di.
Hi,
How did you solve that problem?
My error is "#testing input files [1;31mError: [0mproblem with /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa perl: warning: Setting locale failed. perl: warning: Please check that your locale settings: LANGUAGE = "en_IE:en", LC_ALL = (unset), LC_CTYPE = "UTF-8", LANG = "en_IE.UTF-8" are supported and installed on your system. perl: warning: Falling back to a fallback locale ("en_IE.UTF-8")."
But it didnot say what the problem is.
And my code is :miRDeep2.pl /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa /home/workspace/wangdi/cattle_miRNA/test/5_ref/bta.fa /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185.arf none none none -t Cow
In addition, when I use the bta_mature and bta_hairpin miRNA fasta file (generate from miRBase), the errer is "problem bta_mature.fa".
This really annoys me for weeks. Does anyone have idea about this?
Thanks a lot.
Di.
Log in to answer this question.
