When I input the "clean data" file (In fasta format) in the sRNAbench software, it gives an error message.
I tried entering the raw data file, which is not trimmed for adapter sequences (fastq format) in the sRNAbench software, which worked, but it says that most of the reads mapped to tRNA and there are hardly any microRNAs there.
Do I need a clean fastq file? The software says it accepts fasta files, but I dont know why its not working.
The fasta files look like this:
>@A00920:1001:H7WK7DRX2:1:2101:11360:1031 1:N:0:CCGAAGTA
GNCTGATCCGATGGTAGTGGGTTATCAGAACT
>@A00920:1001:H7WK7DRX2:1:2101:11867:1031 1:N:0:CCGAAGTA
TNGCTTATCAGACTGATGTTGAC
I read somewhere FASTA file for another software miRDeep2 should have the following format: "The fasta files that contain sequencing reads used by miRDeep2 are ordinary fasta files with a predefined identifier format. It comprises three values separated by underscore. The first value is a three letter code which is intended to be a tag for the sample a read is coming from. Example:
>PAN_123456_x969696
ATACAATCTACTGTCTTTCCT
Is that the reason why its not working or sRNAbench as well? If yes, how do I convert my fasta file to this the above format?
0 answers
No answers yet.
Log in to answer this question.
What is the error message?
That is likely not going to work since the reads will contain adapter sequences making it difficult to align miRNA.
Hi @GenoMax,
Thanks for your response. The error is as follows:
ERROR: An error occurred with your job:1JK0SELG72EOZ20 Please report it indicating the jobID.
Yes, exactly! It did work but most of the smallRNAs mapped to tRNAs. I converted the "clean" FASTA file which is trimmed to FASTQ file and it did run but again it says most RNAs detected are tRNAs.