The problems when i map to genome by mapper.pl in miRDeep2
When I did the first step with mirdeep2, which is to map the sequencing data to the genome, I encountered a problem:
First line of FASTA reads file is not in accordance with the fasta format specifications
Please make sure your file is in accordance with the fasta format specifications and does not contain whitespace in IDs or sequences.
My sequencing data is like this,
>@A00808:451:HK3 TGDRXX:2 :2101:1380:1000 1:N:0:CCGAAGTA
CCGGGTGCTGTAGGCTT
>@A00808:451:HK3 TGDRXX:2 :2101:1398:1000 1:N:0:CCGAAGTA
TATGGCACTGGTAGAATTCACT
>@A00808:451:HK3 TGDRXX:2 :2101:2013:1000 1:N:0:CCGAAGTA
AAAAGCTGGGTTGAGAGGGCGA
Isn't this data in FASTA format? How can I solve it?
• 1,315 views
•
link
1 answer
Did you read the error? Are you absolutely sure that your file does not contain whitespaces?
• 0 views
•
link
Log in to answer this question.
I believe mirdeep2 is expecting a FASTA file. What you've provided is not a FASTA file.
Since you said that your data is in fasta format I used the
101010button in editor window to display your example properly. Otherwise>at beginning of lines is shown as quote by Biostars . If it does not exactly look like above then your data is NOT in fasta format.I have examed the file ,there are indeed spaces in the middle, which caused this error, thank you everyone!
Please accept @swbarnes2's answer to provide closure to this thread.