More posts like this
-
Adapter removal using cutadapt and multiqc report:
written by ayeraselvan •Hi, I found a little bit of discrepancy over the fastqc reports after trimming them with cutadapt, (a) FASTQC report before cutadapt: I have downloaded …
-
What is the relationship between Illumina P5 P7, universal adapters, and TruSeq Adapter Index 7?
written by octpus616 •Hi, I am processing a batch of sequencing data, which comes from special library construction technology, and it may contain more adapter sequences than standard …
-
Which adapters to use for trimming?
written by whb •Hi All, I have some Sureselect XT2 and Novaseq data, I used Agilent AGenT trimmer as suggested by Agilent but FASTQC showed that there are …
-
Trim NEBnext Adapters with trimmomatic - Same as TruSeq adapters?
written by alexgoro13 •Hello, I have a similar question. Recently we did NGS library preparation for target enrichment of genomic libraries and we used the NEBNext® Multiplex Oligos …
-
Which truseq trimmomatic adapters file to use when removing truseq adapters?
written by salamandra1 - I'm analysing RNA-seq data from a publication that says adapters used are Truseq. I want to trim adapters from this data with trimmomatic, …
-
Removing Illumina Single End PCR Primers and TruSeq Adapters
written by serpalma.v •Dear community I have 1080 FASTQ files and I've run them all through FastQC to evaluate their quality. Then I aggregated the output with the …
-
RNA-seq adaptor sequence
written by Arindam GhoshI was reading some papers based RNA-seq. In found these details regarding adaptor sequence used in 3 papers: 1. TruSeq RNA sample preperation kit v2, …
-
Amplicon sequencing: how to handle adapters and primers?
written by lamteva.veraDear all, I'm analyzing data from TruSeq Custom Amplicon 1.5 panel. I've read much about handling sequences linked to the original region of interest and …
-
Adapter trimming in basespace
written by kanwarjagI have used NuGEN RNA-seq kit and adapter sequence. is AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (TruSeq Universal Adapter) However in base space (FASTqToolkit) closest one is True seq dual …
-
Understanding Illumina Adapters
written by irritable_phd_syndrome •I am currently working on a project where I need to trim the adapters off of some single end read RNA-Seq data, and I want …
Generally, Illumina reads don't bear too much adapter, you can try fastqc tool to check it