Question from @kanwarjag is about options for BaseSpace so while this answer is generally good it is not applicable in this case.
I have used NuGEN RNA-seq kit and adapter sequence. is AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (TruSeq Universal Adapter) However in base space (FASTqToolkit) closest one is True seq dual HT/LT but it is not completely matching Another option is Ht/Lt common seq of 12 bases. What should be my best choice. In base space I cannot paste my adaptor seq.
PS: I have accidently posted the question in Galaxy, so reposting here.
2 answers
Try Trimmomatic. http://www.usadellab.org/cms/?page=trimmomatic
You can put your adapter sequence in fasta file as an input.
Best,
Agata
1) You can also use bbmap https://sourceforge.net/projects/bbmap/ and the function bbmerge to find the adapter sequence for your data. The output file can be supplemented to BBduk function to remove the adapters.
2) You can use the supplemented Illumina adapters that comes with bbmap to remove if there are any other adapter contamination.
3) finally you need to check how you fastQC report changes after trimming. http://www.bioinformatics.babraham.ac.uk/projects/fastqc/
Thanks,
Question from @kanwarjag is about options for BaseSpace so while this answer is generally good it is not applicable in this case.
I apologize for miscommunication. Thanks for suggestions. However i am clarifying base space options. If some one has used base space please share their thoughts on the issue..
Log in to answer this question.
If the adapter is TruSeq universal that must surely be available for trimming (perhaps done by default) in BaseSpace?