This is a test version of Biostars. For the public version, visit https://www.biostars.org.
What Is The Index Of The First Base In Pph2 ? 0 Or 1 ?

Dear lazyweb, what is the index of the first base in the genome for "PolyPhen-2-Batch Query"? Is it 0 or 1?

Thanks

Pierre

mutation prediction index
• 3,629 views • link
updated by Ram Ram • written by Pierre Lindenbaum Pierre Lindenbaum

Do you mean "in their database" or "when using the web interface"? The UCSC database is 0-based, but the web user is unaware of that because the web front-end converts to 1-based. I would guess that you enter 1-based queries in the form.

• 0 views • link
written by Neilfws Neilfws

2 answers

Hi guys!

PPH2 accepts one-based coordinates in user input web form, similar to UCSC, which always uses 1-based coordinate system in their web interface, even though zero-based system is used throughout the underlying database.

Hope this helps.

Ivan Adzhubei

• 0 views • link
written by Bamyasi Bamyasi

Thanks Ivan for the definitive answer since you maintain PPH2!

• 0 views • link
written by Hanif Khalak Hanif Khalak

PolyPhen uses the same assemblies as UCSC, and according to the UCSC FAQ explanation, the UCSC internal database coordinates are zero-based, so I'd say the first base is a 0.

• 1 views • link
written by Hanif Khalak Hanif Khalak

Thanks, but that is not a proof that PPH2 use an index of 0....

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Log in to answer this question.

More posts like this
  • What does PolyPhen-2 error mean?
    written by Jl • Jl
    Hi all, I'm trying use PolyPhen-2 to analyse my protein data. The input is a protein sequence, but I got the error: ERROR: _calc_ident() Lengths …
  • Polyphen-2 for non-human organisms
    written by Vitis Vitis
    I've been looking at tools to predict variant effects in non-human organisms (other mammalian species). I'm aware of polyphen-2 and SIFT, and really need a …
  • VEP vs webserver Polyphen scores
    written by regrant • regrant
    Hello, I have recently noted a discrepancy the scores given by running PolyPhen at its [website][1] vs getting the PolyPhen score from ensembl's variant effect …
  • Exome Aggregation Consortium (ExAC) database ?
    written by Pierre Lindenbaum Pierre Lindenbaum
    <p>Dear lazyweb,</p> <p>I wonder how data are stored behind the <strong>Exac</strong> server http://exac.broadinstitute.org/ :</p> <ul> <li>SQL only ?</li> <li>SQL+tabix/VCF ?</li> <li>Gemini ?</li> <li>...</li> </ul> <p>Thanks.</p> …
  • output features calculation from various SNP predictor programs
    written by arronslacey arronslacey
    Hi - I want to collect information on SNPs that are often used to predict how damaging they are. For example - using polyphen I …
  • samtools 1.0 'index' : CSI index vs BAI index ?
    written by Pierre Lindenbaum Pierre Lindenbaum
    Dear lazyweb, here is the new menu for `samtools index`: ``` Usage: samtools index [-bc] [-m INT] [out.index] Options: -b Generate BAI-format index for BAM …
  • Polyphen-2 Classifier Model
    written by learnerforever learnerforever
    <p>On the polyphen-2 webpage</p> <p><a href="http://genetics.bwh.harvard.edu/pph2/bgi.shtml">http://genetics.bwh.harvard.edu/pph2/bgi.shtml</a></p> <p>There are two options for the classifier model:</p> <p>HumDiv HumVar</p> <p>Could anyone explain what these are? Is there a …
  • Translating A Mitochondrial Cdna
    written by Pierre Lindenbaum Pierre Lindenbaum
    <p>Here is the cDNA for the UCSC knowngene <strong>uc011mfh.1</strong> , a protein said to be on the <strong>chrM</strong>:5,855-7,427. <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?org=Human&amp;db=hg19&amp;position=uc011mfh.1">http://genome.ucsc.edu/cgi-bin/hgTracks?org=Human&amp;db=hg19&amp;position=uc011mfh.1</a></p> <pre><code>ATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCG TAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTA CTACACGACACGTACTACGTTGTAGCTCACTTCCACTATGTCCTATCAAT AGGAGCTGTATTTGCCATCATAGGAGGCTTCATTCACTGATTTCCCCTAT TCTCAGGCTACACCCTAGACCAAACCTACGCCAAAATCCATTTCACTATC …
  • Biodas : Can I Retrieve Some Metadata About A Segment ?
    written by Pierre Lindenbaum Pierre Lindenbaum
    <p>Hi all,</p> <p>I wonder if there is a <strong><a href='http://www.biodas.org/wiki/Main_Page'>biodas</a></strong> way to retrieve some metadata from a <strong>feature?segment=</strong> query</p> <p>For example: in <a href='http://genome.ucsc.edu/cgi-bin/das/hg18/features?segment=22:14504273,14622020;type=knownGene'>http://genome.ucsc.edu/cgi-bin/das/hg18/features?segment=22:14504273,14622020;type=knownGene</a></p> <pre><code>&lt;?xml …
  • Polyphen2 And Nonsense Codons
    written by Pierre Lindenbaum Pierre Lindenbaum
    <p>Does Polyphen2/batch ( <a href="http://genetics.bwh.harvard.edu/pph2/bgi.shtml">http://genetics.bwh.harvard.edu/pph2/bgi.shtml</a> ) skip the <strong>nonsense</strong> mutations ?</p> <p>I tested it with (hg18) chr22:40053278 C/G the file <strong>pph2-snps.txt</strong> contained the nonsense mutation …