This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Biodas : Can I Retrieve Some Metadata About A Segment ?

Hi all,

I wonder if there is a biodas way to retrieve some metadata from a feature?segment= query

For example: in http://genome.ucsc.edu/cgi-bin/das/hg18/features?segment=22:14504273,14622020;type=knownGene


http://www.biodas.org/dtd/dasgff.dtd">
<DASGFF>
<GFF version="1.0" href="&lt;a href=" http:="" genome.ucsc.edu="" cgi-bin="" das="" hg18="" features"="" rel="nofollow">http://genome.ucsc.edu/cgi-bin/das/hg18/features">
<SEGMENT id="22" start="14504273" stop="14622020" version="1.00" label="22">
<FEATURE id="uc002zkr.2.chr22.14504263.0" label="uc002zkr.2">
 <TYPE id="knownGene" category="transcription" reference="no">knownGene</TYPE>
 <METHOD></METHOD>
 <START>14504264</START>
 <END>14504973</END>

 <SCORE>-</SCORE>
 <ORIENTATION>-</ORIENTATION>
 <PHASE>-</PHASE>
 <GROUP id="uc002zkr.2.chr22.14504263">
  <LINK href="&lt;a href=" http:="" genome.ucsc.edu="" cgi-bin="" hgTracks?position="chr22:14504263-14572999&amp;db=hg18" "="" rel="nofollow">http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr22:14504263-14572999&db=hg18">Link to UCSC Browser</LINK>
 </GROUP>
</FEATURE>

<FEATURE id="uc002zkr.2.chr22.14504263.1" label="uc002zkr.2">
 <TYPE id="knownGene" category="transcription" reference="no">knownGene</TYPE>
 <METHOD></METHOD>
 <START>14542397</START>
 <END>14542487</END>
 <SCORE>-</SCORE>
 <ORIENTATION>-</ORIENTATION>

 (...)

What is 'uc002zkr.2' (geneSymbol, cds Start , ... ) ? I know I can retrieve this information through a mysql query but does BIODAS define a standard protocol to retrieve this kind of indormation ?

Thanks,

Pierre

annotation ucsc xml
• 3,253 views • link
updated by Maximilian Haeussler Maximilian Haeussler • written by Pierre Lindenbaum Pierre Lindenbaum

2 answers

From what I can see UCSC does not even implement the DAS1.5 search-by-id spec, so actually getting more information about a feature this way seems highly unlikely.

none of these work, for example

http://genome.ucsc.edu/cgi-bin/das/hg18/features?feature_id=uc002zkr.2.chr22.14504263.0 http://genome.ucsc.edu/cgi-bin/das/hg18/features?group_id=uc002zkr.2.chr22.14504263.0 http://genome.ucsc.edu/cgi-bin/das/hg18/features?id=uc002zkr.2.chr22.14504263.0

• 1 views • link
updated by Ram Ram • written by Jeremy Leipzig Jeremy Leipzig

I see that you mention the mysql server already, but I'm adding some detail nevertheless: UCSC is not supporting DAS very well. It's because they have thousands of meta data tables and it would be hard to decide how to summarize them into a single string.

It's easier to use the Table Browser's "describe schema" field to find the tables linked to your table of interest and look for the field you're interested in. Then run mysql queries against the public mysql server, as you suggested. Mysql is a lot more flexible than any DAS API could ever be. https://genome.ucsc.edu/goldenPath/help/mysql.html.

• 163 views • link
written by Maximilian Haeussler Maximilian Haeussler

Log in to answer this question.

More posts like this
  • Exome Variant Server: What Are Those Gaps ?
    written by Pierre Lindenbaum Pierre Lindenbaum
    <p>Here is a screenshot of the Exome Variant Server data: </p> <p><img src='http://i.imgur.com/6PfpkHJ.jpg' alt='http://i.imgur.com/6PfpkHJ.jpg' /></p> <p>Does anyone know what those gaps are ? Some deletions …
  • Galaxy "Stitch Maf Blocks" Produced Null Bases
    written by lam • lam
    <p>problem: "stitch MAF blocks" produced NULL bases </p> <p>steps: From <a href='http://genome.ucsc.edu/cgi-bin/das/hg19/dna?segment=chrY:23310464,23331995'>http://genome.ucsc.edu/cgi-bin/das/hg19/dna?segment=chrY:23310464,23331995</a></p> <p>we got the following bases:</p> <pre><code>agtttacccaactcacaggtatttgaggatacaaacccatgactgggcttggctttaaaaattcctatctgaaatttctagt.......... </code></pre> <p>We want to do multiple-species alignment …
  • Hg19 Bed File Compatible With Gatk
    written by kanwarjag kanwarjag
    <p>What will be the best source to download a bed file of hg19 annotation compatible with GATK. USCS browser <a href='http://genome.ucsc.edu/cgi-bin/hgTables?command=start'>http://genome.ucsc.edu/cgi-bin/hgTables?command=start</a> and Biomart can be …
  • Retrieving Features From Certain Position On Genome
    written by vaushev • vaushev
    <p>I would be grateful if anyone can point me to the most appropriate way of querying some genome database (NCBI's, UCSC's - whatever) in order …
  • Error Loading Vcf File In Ucsc Genome Browser
    written by win win
    <p>Hi all, I generated a vcf file using samtools and the wanted to load it into UCSC Genome Browser as suggested at this link</p> <p><a …
  • Igv Genome Viewer: Problems While Loading Dgv Track
    written by romsen • romsen
    <p>Hello, </p> <p>I have problems loading the DGV track in the IGV Genome Browser. It doesn't work. By clicking <br/> File - Loading from Server …
  • Translating A Mitochondrial Cdna
    written by Pierre Lindenbaum Pierre Lindenbaum
    <p>Here is the cDNA for the UCSC knowngene <strong>uc011mfh.1</strong> , a protein said to be on the <strong>chrM</strong>:5,855-7,427. <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?org=Human&amp;db=hg19&amp;position=uc011mfh.1">http://genome.ucsc.edu/cgi-bin/hgTracks?org=Human&amp;db=hg19&amp;position=uc011mfh.1</a></p> <pre><code>ATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCG TAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTA CTACACGACACGTACTACGTTGTAGCTCACTTCCACTATGTCCTATCAAT AGGAGCTGTATTTGCCATCATAGGAGGCTTCATTCACTGATTTCCCCTAT TCTCAGGCTACACCCTAGACCAAACCTACGCCAAAATCCATTTCACTATC …
  • Different Protein Go Annotation Results Depending On Their Source: Uniprot, Amigo, Quickgo...
    written by Pablo Pareja Pablo Pareja
    <p>Hi all,</p> <p>I was wondering what is the criteria for the selection of Gene Ontology annotations in Uniprot entries. </p> <p>For instance, the entry with …
  • Accessing Reactome.Org Using Soap And Curl?
    written by Pierre Lindenbaum Pierre Lindenbaum
    <p>Hi all,</p> <p>I'm trying to send a SOAP query to <a href="http://www.reactome.org/">Reactome</a> using curl.</p> <p>I want to call the remote method <strong>queryPathwaysForReferenceIdentifiers</strong> defined in <a …
  • Phastcons Files
    written by Pierre Lindenbaum Pierre Lindenbaum
    <p>I'm currently looking for the 'probability/score' of a base to be conserved threw the evolution. So I looked at the <a href="http://www.genome.org/cgi/doi/10.1101/gr.3715005">phastCons</a> files at the …