Hi. I'm trying trimming the adapters of my RNAseq and I found the adapter used, is the TruSeq Adapter, Index 1. But, when I use cutadapt or fastx_clipper the adapters remain in the sequences. I think that the size of the adapter make more complex the process of trimming.
I found too that the sequence of adapter is not the complete adapter but a part of that. That is:
TruSeq Adapter, Index 1
Complete = GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
Part = GAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
Maybe I should trimming the adapters using part of then or the correct would be trimming using the complete adapter sequence even if the trimming process is incomplete?
2 answers
Why do you think the adapter remains after using cutadapt? There are very clear instructions for removing illumina TruSeq adapters in cutadapt documentation.
•
written
by
GouthamAtla
If you are not sure what your adapter sequences are, and you have paired-end reads, you can determine them with BBMerge like this:
bbmerge.sh in=reads.fq outa=adapters.fa reads=100k
Then you can trim them with BBDuk, which is able to do a trim both by sequence-matching and overlap, resulting in greater sensitivity and specificity compared to algorithms that only use sequence matching.
(P.S. That command is for interleaved reads; for paired reads in 2 files, use the in1 and in2 flags).
•
written
by
Brian Bushnell
Log in to answer this question.
-
Adapter removal using cutadapt and multiqc report:
written by ayeraselvan •
-
Removing overrepresented sequences in paired end RNA-seq
written by LayneSadler
-
How to remove Illumina TruSeq Index adapters reverse (R2 reads )
written by Info.shi •
-
Which adapters to use for trimming?
written by whb •
-
Galaxy RNASeq Paired-End Reads cutadapt adapter sequence setting
written by schen •
-
Which truseq trimmomatic adapters file to use when removing truseq adapters?
written by salamandra
-
Removing Illumina Single End PCR Primers and TruSeq Adapters
written by serpalma.v •
-
Should adapters for RNASeq be removed before alignment?
written by ddzhangzz
-
questions about TruSeq Adapter
written by miaochenyong •
-
Trimming Adapters
written by newDNASeqer
I usually pass to cutadapt only the first bases of the TruSeq adapter ('AGATCGGAAGAGC'), just like trim_galore. This way you capture several Illumina adapters in one go.
But, can I use one small part of adapter sequence?
Well, the straight answer is yes.
cutadaptwon't mind what sequence you use, of course. Question is, what do you expect to cut?cutadapthas several options about how to detect and trim. I'd suggest to do some experiments by picking or generating few reads which you expect to be trimmed and then play withcutadapt's parameters to see the results.