Samtools Mileup Segmentation Fault
Hi I run the command
samtools mpileup -uf hg18.fa ...
got an error: Segmentation fault I just a guess that something wrong in fa file. I found the last lines in fa file likes:
ggttagggtgtggtgtgtgggtgtgtgtgggtgtggtgtgtgtgggtgtg
gtgtgtgggtgtgggtgtgggtgtgggtgtgtgggtgtggtgtgtgggtg
tggT
That means the last line has not the same length with others. Q1: Is this to acuse it? Q2: Can I manually append NNN.. to the last row? Thanks.
• 3,625 views
•
link
updated
by
Biostar
•
written
by
Zhshqzyc •
•
written
by
Zhshqzyc •
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
segmentation fault (core dumped) when running unikalow
written by Yingzi Zhang
-
Samtools Mpileup Defined Regions
written by Vova Naumov
-
Classifying Query Set Vs Truth Set Overlapping Genomic Ranges
written by 14134125465346445
-
Why Doesn'T Cufflinks Recognize The Gene Names When Using The -G Option
written by le456900 •
-
Mpileup Segmentation Fault
written by AW
-
Finding Somatic Mutations From Whole Exome
written by Angel
-
To Avoid The 'Argument "F" Isn'T Numeric In Numeric
written by Zhshqzyc •
-
Convert A Text File Into A Fasta File
written by Zhshqzyc •
-
Snp Query From Ucsc
written by Zhshqzyc •
-
Using Samtools With Many Positions
written by Zhshqzyc •
A1: no A . If you add more info about how you're calling mpileup, you might get more help. Does hg18.fa.fai exist?
The last line of a fasta file does not need to be the same length as all the others. Please supply the entire samtools mpileup command line. Does the BAM file exist and is it where you think it is? If you run samtools view on the same BAM file, do you also get an error? What version of samtools?
Hello Zhshqzyc!
We believe that this post does not fit the main topic of this site.
No longer relevant after 3.5 years.
For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.
If you disagree please tell us why in a reply below, we'll be happy to talk about it.
Cheers!
Oh the irony! The question is in the front page because you closed it :)
I closed it because it was on the front page ;)
Oh yeah the bump bot. How did I not see that!