This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Convert A Text File Into A Fasta File

Hello, I have a text file likes this:

GTCAAAGATCAGATGGTTGTAGATGTGTGGTGTTATTTCTGAAGCCTCTGTTCAAGGAAGGCAGTTTCTTATGAA

I want to convert it to a fasta file. Can we just manually add a ">" in the fist line?

Thanks

fasta
• 146,651 views • link
updated by Ram Ram • written by Zhshqzyc • Zhshqzyc

Just adding ">" is not a solution, you need biological identifier!

• 0 views • link
written by Thaman Thaman

4 answers

A good explaination of the FASTA format is here:

http://en.wikipedia.org/wiki/FASTA_format

Some applications will use the word immediately after the ">" symbols as an "ID" so make sure it means something to you. You that you can put multiple sequences in the one file, just start each new one with a ">" line, and use a unique ID for each one.

• 441 views • link
written by Torst Torst

Yes. With some added text to identify the sequence.

• 443 views • link
written by Linda • Linda

Yes. As you said, the answer is that simple: simply add '>' at the top of your file. Probably, this is the most simple conversion possible !! :) :)

It is not like converting Fasta back to chromatograms :) :) :)

fasta to scf convertot

• 0 views • link
updated by Ram Ram • written by BioApps BioApps

How the hell would you do that, and why? It looks like you would have to make up the intensity values, and again - why?

• 0 views • link
written by Matt Shirley Matt Shirley

Yes. You are right. The values are 'made up'. The program is just a joke. I had available a library that read FASTA and one that generated SCF files. I only spent few minutes to put them together :) :) :)

• 0 views • link
updated by Ram Ram • written by BioApps BioApps

Log in to answer this question.

More posts like this
  • What Is The Minimum Quality Score
    written by Love • Love
    <p>Hello, I just created a fastq file from samtools. Now I want to do some kinds of quality things since I am not confident the …
  • How To Pull Out Qual From Multi Line Fastq?
    written by Zhshqzyc • Zhshqzyc
    <p>From <a href="http://biostar.stackexchange.com/questions/1389/how-to-generate-a-consensus-fasta-sequence-from-sam-tools-pileup">http://biostar.stackexchange.com/questions/1389/how-to-generate-a-consensus-fasta-sequence-from-sam-tools-pileup</a> We use awk and perl to get fasta by</p> <pre><code>awk '/^@chr1$/,/^+$/' consensus.fastq | perl -pe "s/@/&gt;/ ; s/\\+//" &gt; chr1.fasta </code></pre> <p>The …
  • To Avoid The 'Argument "F" Isn'T Numeric In Numeric
    written by Zhshqzyc • Zhshqzyc
    <p>Hello, I am running the command like:</p> <pre><code>samtools mpileup -uf hg18.fa my.bam | bcftools view -cg - | vcfutils.pl vcf2fq &gt; cns.fq </code></pre> <p>However I …
  • How To Add A Unique Identifier For Fasta File To A Long List Of Sequences
    written by Stevebob • Stevebob
    <p>I have a long list of sequences and I want to convert this list to a fasta file. How do I add &gt; and a …
  • Individual List File Format
    written by Zhshqzyc • Zhshqzyc
    <p>Hi I want to use plink to keep individuals. The command:</p> <pre><code>plink --file data --keep mylist.txt </code></pre> <p>My question is what is the format of …
  • Snp Query From Ucsc
    written by Zhshqzyc • Zhshqzyc
    <p>Hello, I want to a list of snps(HG18). The format likes </p> <pre><code>rs35568883 38782126 A G </code></pre> <p>I know UCSC, but how to query?</p> <p>The …
  • Samtools Mileup Segmentation Fault
    written by Zhshqzyc • Zhshqzyc
    <p>Hi I run the command </p> <pre><code>samtools mpileup -uf hg18.fa ... </code></pre> <p>got an error: Segmentation fault I just a guess that something wrong in …
  • Fasta File Vs Fa File
    written by Zhshqzyc • Zhshqzyc
    <p>Hello, I am going to download fa files by chromsome from <a href="http://hgdownload.cse.ucsc.edu/goldenPath/hg18/chromosomes/">UCSC</a></p> <p>Eventually I want to get a single fasta file. So I have …
  • How To Get Ref.Fasta
    written by Zhshqzyc • Zhshqzyc
    <p>Hi,</p> <p>I want to use samtools command</p> <pre><code>samtools faidx &lt;ref.fasta&gt; [region1 [...]] </code></pre> <p>My question: where can I get ref.fasta or how to create ref.fasta …
  • Using Samtools With Many Positions
    written by Zhshqzyc • Zhshqzyc
    <p>Hi,</p> <p>If one position such as chr8:125976061-125976501, then the command is prety straight forward. In Linux:</p> <pre><code>samtools view -o out input.sam chr8:125976061-125976501 </code></pre> <p>However I …