Hello, I have been using the pbmm2 tool for alignment of long reads. It takes input of the movie.bam files and does the alignment I …

I have a VCF file that uses assembly h19. How can I determine whether the reference sequence that has been used for the mitochondrial chromosome …

Hi. How do I determine allelic fraction from my whole-exome sequencing data? I have FASTQ files and also reference aligned BAM files. Additionally, I have …

Hello, I have imported sample SRA to my local machine, then I have converted the SRA to fastq using sra-toolkit from ncbi. As a next …

I have human Rna-Seq data by reading nanopore. Data has over 1000 .fastq files. I want to trim all fastq files individually. I am using …

Hello, So I'm a bit confused on how the terms gigabase (Gb) and gigabyte (GB) overlap or better said, differ. I am trying to determine …

I have single-end smallRNAseq data and I have to trim the adapter (adapter sequence: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC`). After trimming the adapter using the bbduk command mentioned below, …

Hello~ I am working on my NGS data for gene set enrichment analysis now. I wonder how can I convert my .fastq CleanData received from …

Hi, I have been trying to convert a sra file to fastq and encountered following error message: **fastq-dump.2.1.7 err: data bad version while constructing page …

<p>sorry guys,</p> <p>i am in ribo-galaxy now...in get data part no option to upload a fastq file to pre-processing such as adapter trimming...i can load …