This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Custom proteomes

I am searching for a FASTA file containing the proteome of all known human viruses. I would also be interested in a similar file containing the proteome of all known human pathogenic bacteria, and another one containing the proteome of all known human commensal bacteria. Any suggestion? Thank you!

proteome fasta
• 710 views • link
updated by Ram Ram • written by paolo • paolo

0 answers

No answers yet.

Log in to answer this question.

More posts like this
  • How to create a merged human host viral RefSeq?
    written by MatStat MatStat
    Hi all, I am trying to create **one** viral reference file with all viral RefSeq genomes known in a human host. Basically something like the …
  • Question regarding finding orthologs using proteins of interest and OrthoFinder
    written by Introvertebrate • Introvertebrate
    Hello all! I am currently working on a project in which I am trying to identify orthologs in the proteome of my species using a …
  • Core proteome using local Blast
    written by zarodkip • zarodkip
    Hello all, I am trying to establish a core proteome of A. baumannii, ie the proteins all of the strains have in common. I have …
  • How to carry out a bar-chart distribution of the conservation of orthological groups from a text fi…
    written by BillyBionf • BillyBionf
    I am a bioinformatics intern and I have a problem. I have 2 files,: - f1: one containing the list of viruses infecting several kinds …
  • Appending strings to fasta header from another file
    written by Ming • Ming
    Hello there, I have a A.fasta file containing: >AAL09996.1 ATGTCTAGCAAGCCGTCGAATATGCTTGATGAAGTTACCCTGTATACTCACTACGGCCTATCCGTGGCGAAGAAGCTCGGTGCGAATATGGTCGATGCTTTCCGGTCGGCCTTTTCGGTCAATGATGACATTCGTCAGGTGTATTACCGCGACAAGGGCATCTCTCACGCCAAAGCCGGTCGTTATTCCGAGGCAGTGGTGATGCTCGAGCAGGTTTACGATGCCGATGCCTTCGACGTGGAAGTGGCGCTGCATTTGGGAATCGCCTACGTTAAGACCGGGGCCGTTGATCGCGGCACCGAGTTGCTTGAGCGCTCCATCGCCGATGCGCCTGACAACATCAAGGTCGCGACCGTCCTTGGCCTGACCTATGTGCAGGTGCAAAAATATGATTTGGCCGTGCCTCTACTGGTCAAGGTGGCGGAAGCCAATCCGGTGAATTTCAATGTCCGCTTCCGTCTCGGGGTGGCGCTGGATAATCTGGGCCGCTTTGACGAAGCCATCGACAGTTTCAAGATCGCTTTGGGGCTGCGTCCCAATGAAGGCAAGGTGCATCGCGCAATCGCGTACAGCTACGAGCAGATGGGCTCGCACGAAGAGGCTTTGCCGCATTTTAAGAAGGCCAATGAACTCGATGAACGTTCGGCCGTCTAA >AAR90856.1 ATGTCTAGCAAGCCGTCGGATATTCTTGACGAGGTCACTCTTTACGCTCACTACGGCCTTTCGGTGGCGAAGAAGCTCGGAATGAACATGGTCGATGCGTTCCGTGCGGCCTTTTCCGTCAACGACGACATCCGCCAGGTGTATTACCGCGACAAGGGCATCTCCCACGCCAAGGCCGGGCGCTATTCCCAGGCCGTCATGCTGCTGGAGCAGGTCTACGACGCCGATGCCTTCGATGTGGATGTGGCTCTGCACCTGGGAATCGCCTATGTGAAGACCGGCGCCGTCGATCGCGGCACCGAACTACTCGAACGTTCCTTGGCCGATGCGCCCGACAACGTGAAGGTGGCGACCGTTCTCGGCCTGACCTATGTGCAGGTGCAAAAGTACGATCTGGCCGTTCCGCTGCTGATCAAGGTGGCCGAGGCCAATCCCATCAATTTCAACGTCCGGTTCCGTCTGGGCGTGGCGCTGGACAACCTCGGCCGTTTCGACGAAGCCATCGACAGCTTCAAGATCGCGCTGGGCCTGCGTCCCAATGAAGGCAAGGTGCATCGCGCCATCGCCTTCAGCTATGAGCAGATGGGCCGGCACGAGGAAGCCTTGCCGCATTTCAAGAAGGCCAATGAACTTGACGAAGGGGCCTCGGTCTGA ... I also have another file, A.taxonomy: AAL09996.1 Bacteria;Proteobacteria;Alphaproteobacteria;Rhodospirillales;Rhodospirillaceae;Magnetospirillum;Magnetospirillum gryphiswaldense AAR90856.1 Bacteria;Proteobacteria;Alphaproteobacteria;Rhodospirillales;Rhodospirillaceae;Magnetospirillum;Magnetospirillum magnetotacticum …
  • get repeats for bacteria and viruses to generate simulated reads of repeats
    written by dabid • dabid
    I am trying to simulate reads of repeat regions of bacteria and viruses. I though a database of repeats for bacteria and viruses would be …
  • Non pathogenic bacteria
    written by priyankashrivastava4 • priyankashrivastava4
    I want to know the name of databases or list of **non-pathogenic bacteria** for human? because all the available databases showing only pathogenic bacteria for …
  • How can I find reference composition of bacteria in helathy gut?
    written by agata88 agata88
    Hi all, I am wondering if somebody know a database (files) that contains information about bacteria presented in healthy gut or skin etc.? Another thing: …
  • getting fasta sequences(proteome) from a file referencing another fasta file (tf)of the same organi…
    written by kws15 • kws15
    Hi everyone, Basically I have 2 large fasta sequences file, the first one is the proteome fasta sequences (all the protein sequences), the second one …
  • Blast entire proteomes
    written by soileater • soileater
    How long would it take to blast an Entire Proteome to another one? I mean in a normal PC such as the latest mac mini …