Hello there,
I have a A.fasta file containing:
>AAL09996.1
ATGTCTAGCAAGCCGTCGAATATGCTTGATGAAGTTACCCTGTATACTCACTACGGCCTATCCGTGGCGAAGAAGCTCGGTGCGAATATGGTCGATGCTTTCCGGTCGGCCTTTTCGGTCAATGATGACATTCGTCAGGTGTATTACCGCGACAAGGGCATCTCTCACGCCAAAGCCGGTCGTTATTCCGAGGCAGTGGTGATGCTCGAGCAGGTTTACGATGCCGATGCCTTCGACGTGGAAGTGGCGCTGCATTTGGGAATCGCCTACGTTAAGACCGGGGCCGTTGATCGCGGCACCGAGTTGCTTGAGCGCTCCATCGCCGATGCGCCTGACAACATCAAGGTCGCGACCGTCCTTGGCCTGACCTATGTGCAGGTGCAAAAATATGATTTGGCCGTGCCTCTACTGGTCAAGGTGGCGGAAGCCAATCCGGTGAATTTCAATGTCCGCTTCCGTCTCGGGGTGGCGCTGGATAATCTGGGCCGCTTTGACGAAGCCATCGACAGTTTCAAGATCGCTTTGGGGCTGCGTCCCAATGAAGGCAAGGTGCATCGCGCAATCGCGTACAGCTACGAGCAGATGGGCTCGCACGAAGAGGCTTTGCCGCATTTTAAGAAGGCCAATGAACTCGATGAACGTTCGGCCGTCTAA
>AAR90856.1
ATGTCTAGCAAGCCGTCGGATATTCTTGACGAGGTCACTCTTTACGCTCACTACGGCCTTTCGGTGGCGAAGAAGCTCGGAATGAACATGGTCGATGCGTTCCGTGCGGCCTTTTCCGTCAACGACGACATCCGCCAGGTGTATTACCGCGACAAGGGCATCTCCCACGCCAAGGCCGGGCGCTATTCCCAGGCCGTCATGCTGCTGGAGCAGGTCTACGACGCCGATGCCTTCGATGTGGATGTGGCTCTGCACCTGGGAATCGCCTATGTGAAGACCGGCGCCGTCGATCGCGGCACCGAACTACTCGAACGTTCCTTGGCCGATGCGCCCGACAACGTGAAGGTGGCGACCGTTCTCGGCCTGACCTATGTGCAGGTGCAAAAGTACGATCTGGCCGTTCCGCTGCTGATCAAGGTGGCCGAGGCCAATCCCATCAATTTCAACGTCCGGTTCCGTCTGGGCGTGGCGCTGGACAACCTCGGCCGTTTCGACGAAGCCATCGACAGCTTCAAGATCGCGCTGGGCCTGCGTCCCAATGAAGGCAAGGTGCATCGCGCCATCGCCTTCAGCTATGAGCAGATGGGCCGGCACGAGGAAGCCTTGCCGCATTTCAAGAAGGCCAATGAACTTGACGAAGGGGCCTCGGTCTGA
...
I also have another file, A.taxonomy:
AAL09996.1 Bacteria;Proteobacteria;Alphaproteobacteria;Rhodospirillales;Rhodospirillaceae;Magnetospirillum;Magnetospirillum gryphiswaldense
AAR90856.1 Bacteria;Proteobacteria;Alphaproteobacteria;Rhodospirillales;Rhodospirillaceae;Magnetospirillum;Magnetospirillum magnetotacticum
etc etc
How do I modify the fasta headers so that it appears like this:
>AAL09996.1 Bacteria;Proteobacteria;Alphaproteobacteria;Rhodospirillales;Rhodospirillaceae;Magnetospirillum;Magnetospirillum gryphiswaldense
ATGTCTAGCAAGCCGTCGAATATGCTTGATGAAGTTACCCTGTATACTCACTACGGCCTATCCGTGGCGAAGAAGCTCGGTGCGAATATGGTCGATGCTTTCCGGTCGGCCTTTTCGGTCAATGATGACATTCGTCAGGTGTATTACCGCGACAAGGGCATCTCTCACGCCAAAGCCGGTCGTTATTCCGAGGCAGTGGTGATGCTCGAGCAGGTTTACGATGCCGATGCCTTCGACGTGGAAGTGGCGCTGCATTTGGGAATCGCCTACGTTAAGACCGGGGCCGTTGATCGCGGCACCGAGTTGCTTGAGCGCTCCATCGCCGATGCGCCTGACAACATCAAGGTCGCGACCGTCCTTGGCCTGACCTATGTGCAGGTGCAAAAATATGATTTGGCCGTGCCTCTACTGGTCAAGGTGGCGGAAGCCAATCCGGTGAATTTCAATGTCCGCTTCCGTCTCGGGGTGGCGCTGGATAATCTGGGCCGCTTTGACGAAGCCATCGACAGTTTCAAGATCGCTTTGGGGCTGCGTCCCAATGAAGGCAAGGTGCATCGCGCAATCGCGTACAGCTACGAGCAGATGGGCTCGCACGAAGAGGCTTTGCCGCATTTTAAGAAGGCCAATGAACTCGATGAACGTTCGGCCGTCTAA
>AAR90856.1 Bacteria;Proteobacteria;Alphaproteobacteria;Rhodospirillales;Rhodospirillaceae;Magnetospirillum;Magnetospirillum magnetotacticum
ATGTCTAGCAAGCCGTCGGATATTCTTGACGAGGTCACTCTTTACGCTCACTACGGCCTTTCGGTGGCGAAGAAGCTCGGAATGAACATGGTCGATGCGTTCCGTGCGGCCTTTTCCGTCAACGACGACATCCGCCAGGTGTATTACCGCGACAAGGGCATCTCCCACGCCAAGGCCGGGCGCTATTCCCAGGCCGTCATGCTGCTGGAGCAGGTCTACGACGCCGATGCCTTCGATGTGGATGTGGCTCTGCACCTGGGAATCGCCTATGTGAAGACCGGCGCCGTCGATCGCGGCACCGAACTACTCGAACGTTCCTTGGCCGATGCGCCCGACAACGTGAAGGTGGCGACCGTTCTCGGCCTGACCTATGTGCAGGTGCAAAAGTACGATCTGGCCGTTCCGCTGCTGATCAAGGTGGCCGAGGCCAATCCCATCAATTTCAACGTCCGGTTCCGTCTGGGCGTGGCGCTGGACAACCTCGGCCGTTTCGACGAAGCCATCGACAGCTTCAAGATCGCGCTGGGCCTGCGTCCCAATGAAGGCAAGGTGCATCGCGCCATCGCCTTCAGCTATGAGCAGATGGGCCGGCACGAGGAAGCCTTGCCGCATTTCAAGAAGGCCAATGAACTTGACGAAGGGGCCTCGGTCTGA
The headers will be joined together by a tab.
Thank you and will be appreciate any help.
1 answer
Not the most elegant one liner in the world, but it works. Note, having tabs and whitespace in the header makes life much harder, and makes this solution quite fragile if your taxonomy strings deviate in format much.
join -j 1 <(sort A.taxonomy|sed 's/^/>/gi') <(paste - - < A.fasta | sort) | awk '{print $1 "\t" $2 " " $3 "\n" $4}'
Explained:
join -j 1 <(fileA) <(fileB)
Join fileA based on the first (and only) field, to fileB based on the first field (the >header string). Both files are provided as process substitions <(...) to allow these manipulations:
fileA:
The taxonomy file,
AAL09996.1 Bacteria;Proteobacteria;Alphaproteobacteria;Rhodospirillales;Rhodospirillaceae;Magnetospirillum;Magnetospirillum gryphiswaldense
gets sorted, sort A.taxonomy and then passed to sed which prepends a > so that the strings match for join to use: |sed 's/^/>/gi'. This is all wrapped in a process substitution.
Resulting in:
>AAL09996.1 Bacteria;Proteobacteria;Alphaproteobacteria;Rhodospirillales;Rhodospirillaceae;Magnetospirillum;Magnetospirillum gryphiswaldense
The files themselves should already be sorted, but join often complains if they aren't so its safest to sort them anyway.
fileB:
The fasta file. The sequences are linearised which is handy, but they need to be 'tabulated'.
paste - - < A.fasta | sort
A.fasta is read into paste - - which places the sequences and headers on one line, and they are then sorted for good measure, yielding:
>AAL09996.1 ATGTCTAGCAAGCCGTCGA...
>AAR90856.1 ATGTCTAGCAAGCCGTCGG... #(shortened for the post)
Finally, awk reshuffles all the columns to put the tabs and newlines in to get the desired fasta format:
| awk '{print $1 "\t" $2 " " $3 "\n" $4}'
In this case, $1 is the >header, $2 is the taxonomy, $3 is the species name (annoying white space) and $4 is the sequence.
Log in to answer this question.
What have you tried?
Searching on this site before posting helps.
I would not put a tab in the header of a fasta file, and I personally use python and a dictionary for this.
duplicate: How to match fasta header with the first column of a text file and append the second column of the text file to the end of the fasta header
Hello Ming!
Questions similar to yours can already be found at:
We have closed your question to allow us to keep similar content in the same thread.
If you disagree with this please tell us why in a reply below. We'll be happy to talk about it.
Cheers!