This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Error message: "separator must begin with the '+' sign. cluster 1" during Fastq file upload in BaseSpace

I have some RNASeq raw data which I'm trying to upload in BaseSpace for some downstream analysis. The sequencing was performed in Illumina Nextseq and due to some reasons the data had to demultiplex using reque option.

Now there's this error message separator must begin with the '+' sign. cluster 1 is showing for only one Fastq file. By one file I mean, the other seven files (RNASeq produces eight Fastq files for each sample in Illumina) were smoothly uploaded than this one, FileName_S19_L002_R1_001.fastq.gz.

I checked the file with "validateFastq", "fq" such programs and everything seems ok. Can anyone suggest any other programs to check whats going on?

fastq basespace

A fastq entry looks like this. The quality score identifier line starts with +.

@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC

You can check every third line with awk and get the first character with cut -c 1 and get if there are any other characters then + with uniq

zcat my.fastq.gz | awk 'NR%4==3' | cut -c 1 | uniq

A good practice is to check md5sum if you copy over or downloaded the files from somewhere.

Thanks for your suggestion. I tried this and no missing + appeared. I even wrote python code to check each third line but this also didn't find anything relevant. Then I used fixfq.py but unfortunately, the same error came again. should I consider the file corrupted? P.S: I'm demultiplexing the original file again. I don't know if this may work or not Thanks again!

Hello Sanjana, I faced the same problem. If you have a solution, please tell me. All files were uploaded successfully except one file!

I appreciate any help you can provide.

Looking at this error message again, it can be about anything. You can try writing to basespace support.

0 answers

No answers yet.

Log in to answer this question.