I've downloaded a fastq file from SRA (http://trace.ncbi.nlm.nih.gov/Traces/sra/) containing reads from a paired-end Illumina 101 bp RNAseq experiment. The only problem is, it contains both read pairs in a single file, whereas I need separate files with all the _1.fq reads in one and the _2.fq reads in another.
Can anybody help? I'm aware of the fastq-dump tool within the SRA Toolkit, but I couldn't get it to work when I was originally downloading the data.
Many thanks in advance.
My fastq file looks like this:
$ head sra_data.fastq
@SRR1659960.1.1 1 length=101
NAGAAATGAATGAGCCTACAGATGATAGGATGTTTCATGTGGTGTATGCATCGGGGTAGTCCGAGTAACGTCGGGGCATTCCGGATAGGCCGAGAAAGTGT
+SRR1659960.1.1 1 length=101
#1=BDDDDDHFBFIEHHHHAG<HE@HGGE@HHFGHGGHHFHIHG@FFGGGHIIIIIFAC=F@GEGEECCDCECCBBBBCCCD>9599>C:@>5@9>?CCCD
@SRR1659960.1.2 1 length=101
CCCACTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATCATAGGAGGCTTCATTCACTGATTTCCCCTATTCTCAGGCTACACCCTAGACCAAACC
+SRR1659960.1.2 1 length=101
<7?BD?DD<DFFABBEHEEFHII>C:BCDD?<C?FFC4E>@DEF>?FGHDFBBCG8??DGGIII:BF@C=FFC;C=D;@?EA76?DDBEC?>>ACCCABBB
@SRR1659960.2.1 2 length=101
NATAAAGTGTATGACAAATATACAAGGCTCCTAATATTGGTTTAACTTGGAGAAGTAGGTAAAGGAAGAAGGGNAAAGGAAATAGACAAAAAGACTACAGT
3 answers
Use Reformat from the BBMap package:
reformat.sh in=sra_data.fastq out1=r1.fq out2=r2.fq interleaved
•
written
by
Brian Bushnell
I've tried this, but I get the following error message:
$ sratoolkit.2.5.4-1-centos_linux64/bin/fastq-dump --split-files sra_data.fastq
2015-10-15T22:59:03 fastq-dump.2.5.4 err: item not found while constructing within virtual database module - the path 'sra_data.fastq' cannot be opened as database or table
Log in to answer this question.
-
Expected number of read duplicates
written by dariober
