Hi all,

I have had a question the until now I could not find a clearly answer. I have some data for RNA seq that I have aligned. Observing the alignment done by STAR in IGV, I see things like this one:

My question here is: Which is the right direction of the transcript that produces the reads, knowing that the RNA-seq has been done in Single end?

I am little confused here because : If I look for the 3 first reads (at the top in blue) into my fastq file of RNA seq reads, these reads are:

@SRR.139896188
TCTGCAGACACCCTTCTCCGGCCGGAGCTG
+
AAAAAFF7FAFFFFFFFFFFFFFFFFFFAF
@SRR.107479696
TCTGCAGACACCCTTCTCCGGCCGGAGCTG
+
AAAA<FFAFAFFFFFFFFFFAFFFFFFFFF
@SRR.40743323
TCTGCAGACACCCTTCTCCGGCCGGAGCTG
+
AAAAAFF)FAFFFFFFFFFFFFFFFFFFFF

But in my alignment file (sam file) the reads look like this :

SRR.139896188   16  chr1    136042  255 30M *   0   0   CAGCTCCGGCCGGAGAAGGGTGTCTGCAGA  FAFFFFFFFFFFFFFFFFFFAF7FFAAAAA  NH:i:1  HI:i:1  AS:i:27 nM:i:1

SRR.107479696   16  chr1    136042  255 30M *   0   0   CAGCTCCGGCCGGAGAAGGGTGTCTGCAGA  FFFFFFFFFAFFFFFFFFFFAFAFF<AAAA  NH:i:1  HI:i:1  AS:i:27 nM:i:1

SRR.40743323    16  chr1    136042  255 30M *   0   0   CAGCTCCGGCCGGAGAAGGGTGTCTGCAGA  FFFFFFFFFFFFFFFFFFFFAF)FFAAAAA  NH:i:1  HI:i:1  AS:i:27 nM:i:1

So, the reverse complement of these reads is aligned in the genome Is this meaning that the direction of the transcript is the reverse sens of the genome ?

For these blue reads, here the preparation library protocol used:

Fragment polyadenylation, Linker ligation to do after reverse transcription, Then circularization to deplete ribosomal RNA, Next PCR- Amplification and Sequencing - single layout on NextSeq 500

What if I look again in the image : the red reads are aligned in the same sens as they are in the fastq (RNA reads). So, I might say that the transcript direction is the actual direction of the genome showed in the image?

For these red reads, here the preparation library protocol used:

cDNA synthesis and library generation performed according to TruSeq Stranded Total RNA Sample Preparation protocol (Illumina). mRNA-seq libraries was subjected to sequencing on a NextSeq 500 instrument (Illumina) to yield 75 bp single-end reads.

I hope to be clear enough to have a clear answer. :)

Thanks in advance.