Shannon's Entropy by Sliding Window in R
Hellow there. I have a fasta file containing aligned sequences (around 1,000). I need to calculate the entropy using the sliding window method on this file. How can this be done in R?
sequence
window
r
entropy
sliding
• 2,534 views
•
link
updated
by
rohitsatyam102
95
• |
written
by
Alex
0
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Pairwise alignment and Ka/Ks computation
written by maxime.policarpo 20Dear all, I have a multi-fasta file which consists in 1,000 coding sequences. I would like to compute the Ka/Ks between each pair of sequences. …
-
Identify most and least abundant allele (nMAJ and nMIN) for pooled heterozygosity (hp) analysis fro…
written by tothepoint 94I am trying to calculate Pooled Heterozygosity (hp) by identifying nMAJ and nMIN from vcf file with a sliding window 150kb. I am confused after …
-
DNA sequence complexity with a sliding window
written by User000 75Dear all, I have fasta seguence like this: CCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCCCTTTT I would like to calculate the complexity of this sequence based on sliding window of 3-4 …
-
Sliding window analysis for angsd output
written by wumy 0Hi everyone, I am trying to do a sliding window analysis on my dxy output from ANGSD. My data is whole-genome and I have calculated …
-
Multi-fasta sequence file alignment using sliding window
written by susheelbhanu 0Dear all, I am trying to align two fasta files with multiple sequences. The idea would be to use a sliding window approach, as done …
-
Sliding Window to cluster sequence in multi fasta in R.
written by adhirajnath14 4I have a multi-fasta file with thousands of sequences of ~1000bp each. I need to divide them as sliding window into length 100 and 120 …
-
Calculating the sequence similarity and percentage of matched sequences
written by ago1mutant 1I have multiple aligned fasta files containing two sequences. I would like to know the sequence similarity and percentage of matched sequences. Are there any …
-
sliding windows with or without overlap?
written by Yu 14Dear all, I am confused about sliding window method, we often using this method to analysis ChIP-seq data or Copy number variation(CNV). Sliding windows w/o …
-
Aligning genome wide coding sequences of two species for Ka/Ks calculation
written by shreyasibiswas88 3Hi, I have two fasta files each containing ~300,000 sequences of coding exons for one species. Both species are mapped to the same reference and …
-
how can I retrieve FASTA sequence using ID in another text file?
written by tcf.hcdg 7Dear BIostar community I have around 50,000 sequence identifier in a text file and around 1Million sequences in a large fasta file. I want to …
what did you try so far ? Show us the code.
To be honest, I haven't tried anything. I've never come across this topic before. I don't know much about python, so I'm looking for a solution in R if it exist
I would suggest starting by googling "apply function in sliding window in R". Learning how to google and find stuff out like this is the most important skill in bioinformatics. People here are very willing to help, but you have to show some effort first.
Okay, thank you
zoo::rollapplyis your friendIf I remember correctly, TFBStools package in R has a
shannon.entropy()function that you could use, maybe you need to calculate it per position and take mean over every window?Yes I do this
Hi
Were u able to achieve this?