Is it possible to download EMBOSS complex? or is it a web based tool? I am having trouble understanding it.
Dear all,
I have fasta seguence like this:
CCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCCCTTTT
I would like to calculate the complexity of this sequence based on sliding window of 3-4 nucleotides, and plot a graph with a score or something similar, in order to identify regions like "CCCC","TTTT","AAAA".
Is there a software that does something similar? OR alternatively how can I do this?
1 answer
The problem is I cannot open the link it does not work.
Which link are you referring to? Link in original answer is simply for the manual page of complex program. As for the link I provided above that is for the command line EMBOSS package you can download. It is not a ready to run program link.
I mean the ftp link to download the program: ftp://emboss.open-bio.org/pub/EMBOSS/
Here is a direct link for the latest EMBOSS.
I do not know why, I cannot open it.
I will directly paste the link here: ftp://emboss.open-bio.org/pub/EMBOSS/emboss-latest.tar.gz
For some reason the new biostars code is not parsing that link. We are going to investigate.
ok I downloaded the link you sent we with wget,otherwise it does not open... thanks a lot!
Sorry, I cannot find a complex in the EMBOSS I downloaded...
Sigh. You are correct. It looks like that tool was removed from latest EMBOSS. Since original link seems to suggest that it was in v.6.0 you could try to download an older version from here: ftp://emboss.open-bio.org/pub/EMBOSS/old/
There is this review for similar tools see if you can find a copy to get additional options perhaps.
Could you please give me a link with a tar.gz file, I cannot open the link i can only download with wget
thanks, I could make it work, do you know where and if I can find a manual for emboss complex? it is not clear how it calculates the complexity.
Manual was linked by Shelkmike in the original post above: http://emboss.sourceforge.net/apps/release/6.0/emboss/apps/complex.html
You can just run complex on its own. It should produce some in-line help.
there was a "bug" with the code, ftp links were not allowed to pass, this has been fixed.
Log in to answer this question.
you need to mention window size and step size. In addition, please post how you would calculate the complexity. If you want to generate multiple sequences with defined window and step sizes from a single sequence,
seqkit windowfunction would help.window size of 3-4 nucleotides and step of 1 nucleotide. I am not sure how to calculate the complexity, it is like I want to find and homopolymers in the sequence and plot them on a graph, so if there are homopolymers I would like to see a pick.