Dear all,
I have fasta seguence like this:
CCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCCCTTTT
I would like to calculate the complexity of this sequence based on sliding window of 3-4 nucleotides, and plot a graph with a score or something similar, in order to identify regions like "CCCC","TTTT","AAAA".
Is there a software that does something similar? OR alternatively how can I do this?
1 answer
I mean the ftp link to download the program: ftp://emboss.open-bio.org/pub/EMBOSS/
Here is a direct link for the latest EMBOSS.
I will directly paste the link here: ftp://emboss.open-bio.org/pub/EMBOSS/emboss-latest.tar.gz
For some reason the new biostars code is not parsing that link. We are going to investigate.
Sigh. You are correct. It looks like that tool was removed from latest EMBOSS. Since original link seems to suggest that it was in v.6.0 you could try to download an older version from here: ftp://emboss.open-bio.org/pub/EMBOSS/old/
There is this review for similar tools see if you can find a copy to get additional options perhaps.
Manual was linked by Shelkmike in the original post above: http://emboss.sourceforge.net/apps/release/6.0/emboss/apps/complex.html
You can just run complex on its own. It should produce some in-line help.
there was a "bug" with the code, ftp links were not allowed to pass, this has been fixed.
Log in to answer this question.
-
Enrichment plot in R with custom pathways
written by User000
-
Gene Prediction by using Python
written by anasjamshed
-
Multi-fasta sequence file alignment using sliding window
written by susheelbhanu •
-
Is there some good software to align/compare fasta sequences in my PC
written by silas008
-
The pooled heterozygosity (Hp) score
written by Siavash Salek Ardestani •
-
Looking for a database containing the least-conserved, most highly polymorphic SNPs (or regions) of…
written by fwuffy
-
MSA scoring tools/scripts
written by Joe
-
Peak calling for TF and histone modification
written by tonja.r
-
Plotting LD decay in window
written by Adrian Pelin
-
selection sweep. Sliding window
written by somakina •
you need to mention window size and step size. In addition, please post how you would calculate the complexity. If you want to generate multiple sequences with defined window and step sizes from a single sequence,
seqkit windowfunction would help.window size of 3-4 nucleotides and step of 1 nucleotide. I am not sure how to calculate the complexity, it is like I want to find and homopolymers in the sequence and plot them on a graph, so if there are homopolymers I would like to see a pick.