This is a test version of Biostars. For the public version, visit https://www.biostars.org.
FastqPuri Qreport fails

Hi,

I managed to install FastqPuri and I am trying to use Qreport on a basic fastq set (Tested on MacOs with Qreport version: 1.0.8)

I launched this particular command line: Qreport -i ./data/FASTQs/test_R2.fastq.gz -l 101 -o ./outs/qreport_test_R2

This is the current output:

Qreport from FastqPuri
- Input file: ./data/FASTQs/GTEX-N7MT-0126-SM-26GMB/GTEX-N7MT-0126-SM-26GMB_R2.fastq
- Read length: 101
- Number of tiles: 96
- Min quality: 27
- Qualities for properties plot: 27,33,37
- Output bin-file : ./outs/qreport_R2.bin
- Output html-file : ./outs/qreport_R2.html
- Output info-file: ./outs/qreport_R2.info
Starting Qreport at: Mon Jun  6 10:27:58 2022
- Reading a filtered file? no.
Warning: tile number not found in the following fastq-header:
@SRR627447.1 1 length=101
FastqPuri/Qreport neglects information and plots based on tile numbers.
     1000000 reads have been read.
     2000000 reads have been read.
     3000000 reads have been read.
     4000000 reads have been read.
     5000000 reads have been read.
     6000000 reads have been read.
     7000000 reads have been read.
     8000000 reads have been read.
     9000000 reads have been read.
    10000000 reads have been read.
    11000000 reads have been read.
    12000000 reads have been read.
    13000000 reads have been read.
    14000000 reads have been read.
    15000000 reads have been read.
    16000000 reads have been read.
    17000000 reads have been read.
    18000000 reads have been read.
    19000000 reads have been read.
    20000000 reads have been read.
    21000000 reads have been read.
    22000000 reads have been read.
    23000000 reads have been read.
    24000000 reads have been read.
    25000000 reads have been read.
    26000000 reads have been read.
    27000000 reads have been read.
- Finished reading file.
  WARNING: expected 96 tiles but found only 1.
- Writing data structure to file ./outs/qreport_R2.bin.
WARNING: html reports are NOT being generated.
         Dependencies not fulfilled.
Finishing program at: Mon Jun  6 10:28:47 2022
Time elapsed: 49.202761 s.

I am struggling to understand if this error is due to my files or specific flags I didn't correctly set. I have tested puting the -t flag to 1 and giving a decompressed version of the fastq without any progress. Qreport -i ./data/FASTQs/test_R2.fastq -l 101 -o ./outs/qreport_test_R2 -t 1

Here is the head of my test:

@SRR627447.1 1 length=101
CTGGCNTTGGCCCTGGGAGAGCAGGTGGAAGATCAGGCAGGCCATCGCTGCCGCAGAACCCAGTGGATTGGCCTAGGTGTGATCACCGAGCTTCACAAGCC
+SRR627447.1 1 length=101
@CCFF#2BDHHHHJJJIIJGIJJJGBFHGIJJJJJIJJJIJIJJGIJJJJJJGGHFFEEDDBDC@CCCD?BDDD:?CCD(8>C>3?(25<B##########
@SRR627447.2 2 length=101
GGAATCCCGAAGAAATGGTGGGTCTTGGCCATCCGTGAGATCTTCCCCGGGCAGCTCCCCTCTGTGGAATCCAATCTGTCTTCCATCCTGCGTGGCCGAGG
+SRR627447.2 2 length=101
:=<A;D>D208C@G@:CFAFE6:)1?GGF919B:@?DC)*0?4B#########################################################

Can you please give me some pointers over what is wrong?

Thank you very much.

rna-seq qc fastqpuri

1 answer

My hunch is this program is expecting fastq headers to be in the Illumina fastq format. As you can see yours are in the SRA format.

You could try and re-extract the SRA dataset using -F option to recover Illumina fastq headers (IF original submitters had submitted them). Otherwise stay with something familiar like FastQC.

Hi, I have tested to recover the dummy SRR from SRA and try the -F flags (nd also --origfmt) without any success. I will probably switch to FastQC if theses tests abort.

Thank you for your help.

Log in to answer this question.