Hi Guys,
While running GATK, I am getting ERROR MESSAGE: SAM/BAM/CRAM file bwa/aln-SRR13785703.bam is malformed. Please see https://software.broadinstitute.org/gatk/documentation/article?id=1317for more information. Error details: SAM file doesn't have any read groups defined in the header. The GATK no longer supports SAM files without read groups
So, there is a need to add read groups using picard tool (AddOrReplaceReadGroups) but for that I need parameters like RGID, RGLB, RGPL and RGPU. The sequencing platform I know, but how to get information regarding sequence library and barcode. I checked fastq header but there is no such information. The data has been fetched from SRA (SRR13785703). Please help me in this regard.
My fastq header is like: head SRR13785703_1.fastq
@SRR13785703.1 1 length=101 TNGCTGTGTCACACATTAAGCCAGGGGACTTTGCACCTCATTGCCTGGGGTCGGTTGGGGAGCTCCAGCTGCTCTGCCTGTTACTTTCCGGCCAGAGCCCA +SRR13785703.1 1 length=101 F#FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF @SRR13785703.2 2 length=101 TNGACCTGTGTGGGTCCGTCTTGGGGTTCCCTCGTTGAACATGCTGTCAAACCAGGACACTGGCTCCAGCTTGTGTTTCTGCTCTTGGCCATCGTCTGGGA +SRR13785703.2 2 length=101 F#FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF @SRR13785703.3 3 length=101 GNCCGCCGCTGGCCCTGTGCGAGCACCTCGTCCGGCCAGGCGTCCCGCAGCTGCTGCAGCCGCGCTCGCGCCGCCTCCAGCTCCGCGAGCTGCTCGCGCTC
0 answers
No answers yet.
Log in to answer this question.
-
Does read group id need to be unique between multiple bam files?
written by antmantras •
-
GATK based variant calling yields excessive Indels
written by evoclive •
-
Input arguments for AddOrReplaceReadGroups (Picard) from fastq
written by shpak.max •
-
How to split multi run bam files and add read groups
written by MAPK
-
How treat a Bam file with mutiple read groups (RG)
written by zamani_2012 •
-
Can I get AddOrReplaceReadGroups working for multiple files?
written by James Reeve
-
CALLING SNPS afther aligmnet with BBMap
written by cristina_sabiers
-
How do I find input arguments (RGPU, RGLB, etc) for AddOrReplaceReadGroups
written by Max
-
GATK, SAM file doesn't have any read groups defined in the header
written by Chirag Nepal
-
Picard Addreplacereadgroup Error: Rg Id Not Found In Header
written by William
the error is quite clear and is unrelated to your reads
GATK, SAM file doesn't have any read groups defined in the header
GATK: SAM file doesn't have any read groups defined in the header.
Hello shivangi.agarwal800!
Questions similar to yours can already be found at:
We have closed your question to allow us to keep similar content in the same thread.
If you disagree with this please tell us why in a reply below. We'll be happy to talk about it.
Cheers!
Thanks Pierre Lindenbaum
I have already seen this post and many others. I understand that I have to add read groups to my bam file. But my concern is I am not getting the information about sequence library and barcode in my fastq or SRA file (this is required in order to add readgroups). From where, this information I can get it?? I need help in regard to this.
you can put whatever you want. Ususally you put the sample name by default for anything:
RGID=SRR13785703 RGSM=SRR13785703 RGLB=SRR13785703 RGPU=SRR13785703 RGPL=ILLUMINA