More posts like this
-
Assembly of chloroplast genome from plant WGS
written by adarsh 8Hi, I want to perform de novo assembly of chloroplast genome. However chloroplast enrichment was not performed during sequencing, so the final data contains the …
-
Discovery of reads originating from the chloroplast with multiple congeners' reference
written by Plant_man_217 0I am trying to figure something out, but I might be over thinking it. I have some RADseq data for a non-model plant species and …
-
which tool to use for Transposon structure finding CENSOR or repeat masker ??
written by manaswiniparija3 6I have a nucleotide sequence as a query. I need to align the respective organisms' reference genomes and identify if there is an inverted repeat …
-
Chloroplast genome phylogenetic analysis
written by a.bibek52 1Hello Biostars, Can anybody help me to know whether I have to correct the direction (reverse complement) the Short Single Copy (SSC) region of the …
-
detection of inverted repeats of transposons in Bacteria
written by bas1993 6I found several transposase genes in a bacterial assembly and I now want to determine the size of the insertion sequence. In literature I read …
-
Downloading specific gene sequences within a genome from genbank using biopython
written by Wilber0x 7Is there a way to download specific gene sequences from genbank using Seq.IO and the gene IDs? I know how to download a genome sequence …
-
best alignment tool for Ion Torrent data
written by Ann 241Hello, I am teaching a Genomics Biotechnology class this semester at UNC Charlotte and have a question about the best alignment tool to use for …
-
Filling in inverted repeat gaps (chloroplast)
written by lisakim2017 1<p>Hello, I was wondering if anyone could help me figure out how to map inverted regions. I have made my assembly of contigs, and have …
-
TRF output to .gff file
written by Alice 32Hello, biostars! I'm trying to get .gff file from Tandem Repeat Finder output. Since TRF can't do that, I've found TRAP tool, which can create …
-
Is There Is Tool For Variable Tandem Repeats Finding?
written by zeleniy.spb 3For example I have the next sequence: ``` ACGAGGTTACTACTACTAGTACTACGCC # _________^^^______ ``` As you can see there is a tandem repeat with monomer TAC. But …