Removal of inverted repeat copy from chloroplast genome
Is there a command line tool available for removing one copy of the inverted repeat from a chloroplast genome sequence?
sequence
• 471 views
•
link
written
by
Wilber0x •
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Assembly of chloroplast genome from plant WGS
written by adarsh •Hi, I want to perform de novo assembly of chloroplast genome. However chloroplast enrichment was not performed during sequencing, so the final data contains the …
-
Discovery of reads originating from the chloroplast with multiple congeners' reference
written by Plant_man_217 •I am trying to figure something out, but I might be over thinking it. I have some RADseq data for a non-model plant species and …
-
which tool to use for Transposon structure finding CENSOR or repeat masker ??
written by manaswiniparija3 •I have a nucleotide sequence as a query. I need to align the respective organisms' reference genomes and identify if there is an inverted repeat …
-
Chloroplast genome phylogenetic analysis
written by a.bibek52 •Hello Biostars, Can anybody help me to know whether I have to correct the direction (reverse complement) the Short Single Copy (SSC) region of the …
-
detection of inverted repeats of transposons in Bacteria
written by bas1993 •I found several transposase genes in a bacterial assembly and I now want to determine the size of the insertion sequence. In literature I read …
-
How to annotate chloroplast genome
written by kristina.mahanI mapped sequencing reads to a published chloroplast genome. A annotation file is available for the reference chloroplast genome. How can I annotate the bam …
-
best alignment tool for Ion Torrent data
written by AnnHello, I am teaching a Genomics Biotechnology class this semester at UNC Charlotte and have a question about the best alignment tool to use for …
-
Filling in inverted repeat gaps (chloroplast)
written by lisakim2017 •<p>Hello, I was wondering if anyone could help me figure out how to map inverted regions. I have made my assembly of contigs, and have …
-
TRF output to .gff file
written by AliceHello, biostars! I'm trying to get .gff file from Tandem Repeat Finder output. Since TRF can't do that, I've found TRAP tool, which can create …
-
Is There Is Tool For Variable Tandem Repeats Finding?
written by zeleniy.spb •For example I have the next sequence: ``` ACGAGGTTACTACTACTAGTACTACGCC # _________^^^______ ``` As you can see there is a tandem repeat with monomer TAC. But …