This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Is There Is Tool For Variable Tandem Repeats Finding?

For example I have the next sequence:

ACGAGGTTACTACTACTAGTACTACGCC
#      _________^^^______

As you can see there is a tandem repeat with monomer TAC. But because of mutation one monomer now is TAG and, for example, exact-tandems tool cannot recognise TACTACTACTAGTACTAC as one repeat. So how can I identify TACTACTACTAGTACTAC as one repeat, not two separated by TAG sequence?

tandem-repeats
• 8,116 views • link
updated by Ram Ram • written by zeleniy.spb • zeleniy.spb

6 answers

Try the old and still working Tandem Repeat Finder http://tandem.bu.edu/trf/trf.html

• 94 views • link
written by JC JC

The common reason to use TRF is that has been used by a lot of other researchers, and is well cited. However, benchmarks show that it lacks sensitivity, without being particularly specific. Thus, I'd recommend using other tools, or at least adding results from other tools.

• 0 views • link
updated by Ram Ram • written by Elke Schaper • Elke Schaper

Quite a lot of reviews have been published on the topic. Have a look at e.g.

Detecting short tandem repeats from genome data: opening the software black box

Repeat or not repeat?- Statistical validation of tandem repeat prediction in genomic sequences

Among many more tools (>50), there is:

XSTREAM

T-REKS

Perhaps useful, we've implemented the Python3 library TRAL to allow among others easy running, parsing and merging of tandem repeat detection tools.

• 0 views • link
updated by Ram Ram • written by Elke Schaper • Elke Schaper

See also, MEME-suite (http://meme-suite.org/doc/meme-format.html). It's different tools by which you can discover new repeats (MEME), can look for repeat/motif enrichment in particular region of the genome (CentrMo), can scan your repeat/motif in the genome (FIMO) and many more related analysis.

• 0 views • link
written by kashiff007 kashiff007

Why don't you take a look at EMBOSS etandem? And here is the manual -> link

• 1 views • link
written by Jordan Jordan

Also, check out MISA

Beier S, Thiel T, Münch T, Scholz U, Mascher M (2017) MISA-web: a web server for microsatellite prediction. Bioinformatics 33 2583–2585. dx.doi.org/10.1093/bioinformatics/btx198

• 0 views • link
written by Sukhi Singh Sukhi Singh

Log in to answer this question.

More posts like this