This is a test version of Biostars. For the public version, visit https://www.biostars.org.
TRF output to .gff file

Hello, biostars!

I'm trying to get .gff file from Tandem Repeat Finder output.

Since TRF can't do that, I've found TRAP tool, which can create .gff. But, TRAP creates as many .gff files as the number of contigs (ok, there is 'cat' command).

The main problem is lines of .gff:

.    TRF    satellite    1    72    144    +    .    note "satellite sequence" "TRF parameters   2 7 7 80 10 50 2000" "repeat unit size = 2" "copy number = 36.0" "predicted by Tandem Repeats Finder 4.07b" ; label "satellite" ; rpt_type "tandem" ; rpt_unit "TA" ; color 9
.    TRF    satellite    452    512    69    +    .    note "satellite sequence" "TRF parameters   2 7 7 80 10 50 2000" "repeat unit size = 14" "copy number = 4.7" "predicted by Tandem Repeats Finder 4.07b" ; label "satellite" ; rpt_type "tandem" ; rpt_unit "TTCTCCATTAATTA" ; color 9
.    TRF    satellite    453    498    74    +    .    note "satellite sequence" "TRF parameters   2 7 7 80 10 50 2000" "repeat unit size = 23" "copy number = 2.0" "predicted by Tandem Repeats Finder 4.07b" ; label "satellite" ; rpt_type "tandem" ; rpt_unit "TCTCCATTAATAATTCTCCATTA" ; color 9

Instead of seq. name there are . TRF. Therefore it is impossible to sort this .gff file.

Is there any tool for obtaining 'normal' .gff file or any script to produce such a file from TRF output?

PS: RepeatMasker makes .gff files, but my aim is creating one .gff file from several tools, thus i'm going to intersect two or three .gff files.

next-gen
• 6,108 views • link
updated by Adam Taranto • Adam Taranto • written by Alice Alice

2 answers

Here is a quick python script that I use for this purpose. It uses the latest version of TRF, with the -ngs flag to get the compact output. Not very well tested yet, so use at your own risk:

• 0 views • link
updated by Ram Ram • written by lexnederbragt lexnederbragt

Thank you! Very useful, I'll try it.

• 0 views • link
written by Alice Alice

Excuse me, I also meet this question, I wonder where is your python code, thank you!

• 1 views • link
written by yinliduo • yinliduo

You can do this with the python package TRF2GFF, it takes the dat file output from trf and converts in into gff3 format.

• 0 views • link
written by Adam Taranto • Adam Taranto

Log in to answer this question.

More posts like this